Institut de Génétique et Microbiologie

CRISPR Utilities


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links


Page manual

Exhaustive DR List and DRs alignement

Selection Sequence ID DR sequence Length

NC_000853_1
NC_000853_2
NC_000853_3
NC_000853_4
NC_000853_5
NC_000853_8
NC_009486_4
NC_009486_6
NC_009486_8
NC_009486_9
NC_010483_4
NC_010483_7
NC_010483_8
NC_013642_3
NC_013642_6
NC_013642_7
NC_013642_8
NC_023151_1
NC_023151_2
NC_023151_3
NC_023151_4
NC_023151_5
NC_023151_7
NZ_CP010967_1
NZ_CP010967_2
NZ_CP010967_3
NZ_CP010967_4
NZ_CP010967_8
NZ_CP011107_1
NZ_CP011107_2
NZ_CP011107_3
NZ_CP011107_4
NZ_CP011107_8
NZ_CP011108_1
NZ_CP011108_2
NZ_CP011108_3
NZ_CP011108_4
NZ_CP011108_8
GTTTCAATAATTCCTTAGAGGTATGGAAAC
30

NC_000853_6
NC_000853_7
NC_010483_6
NC_011978_2
NC_011978_4
NC_011978_7
NC_023151_6
NZ_CP007633_2
NZ_CP007633_6
NZ_CP007633_7
NZ_CP010967_6
NZ_CP010967_7
NZ_CP011107_6
NZ_CP011107_7
NZ_CP011108_6
NZ_CP011108_7
GTTTCAATACTTCCTTAGAGGTATGGAAAC
30

NC_000854_2
NC_000854_4
NC_022521_3
NC_022521_6
GAATCTTCGAGATAGAATTGCAAG
24

NC_000854_3
NC_022521_4
GCATATCCCTAAAGGGAATAGAAAG
25

NC_000868_1
NC_000868_4
NC_000961_6
NC_003413_1
NC_015474_1
NC_015474_2
NC_018092_8
NZ_CP010835_7
NZ_LN999010_5
CTTTCAATTCTATTTTAGTCTTATTGGAAC
30

NC_000868_2
CTTTCCACACTACTAAGTTCTACGGAAAC
29

NC_000868_3
TTTCAATTCTATTTTAGTCTTATTG
25

NC_000909_1
NC_000909_20
NC_000909_4
NC_000909_5
ATTAAAATCAGACCGTTTCGGAATGGAAAT
30

NC_000909_10
NC_000909_12
NC_000909_16
NC_000909_17
NC_000909_18
NC_000909_19
GTTAAAATCAGACCTCTTGGAGGATGGAAA
30

NC_000909_11
GTTAAAATCAGACCGTTTCGGAATGGAAAC
30

NC_000909_13
GTTAAAATCAGACCTCTTGGAGGATGGAAAT
31

NC_000909_14
ATTAAAATAAGACCGTTTCGGAATGGAAAC
30

NC_000909_15
GTTTCCATACAATGTTGTTCTTCTTAAAC
29

NC_000909_2
ATTTCCATTCCGAAACGGTCTGATTTTAAC
30

NC_000909_3
ATTTCCATCCTCCAAGAGGTCTTATTTTAAT
31

NC_000909_6
ATTTCCATTCCCCGAGGGATCTGATTTTAC
30

NC_000909_7
TAAAATTATGGTGGGCTCGGGGAGAT
26

NC_000909_8
NZ_CP009149_14
GTTAAAATCAGACCGATTCGGAATGGAAAC
30

NC_000909_9
GTTTCCATACAACAATGTTCTTCTTAAAC
29

NC_000912_2
NZ_CP008895_1
NZ_CP008895_2
NZ_CP010538_1
NZ_CP010538_2
NZ_CP010542_1
NZ_CP010542_2
NZ_CP010543_1
NZ_CP010543_2
NZ_CP010544_1
NZ_CP010544_2
NZ_CP010545_1
NZ_CP010545_2
NZ_CP013829_1
NZ_CP013829_2
NZ_CP014267_1
NZ_CP014267_2
GGTTCTACAACTACTTCTGGTTGAA
25

NC_000913_4
NC_002655_3
NC_002695_4
NC_007613_3
NC_007779_4
NC_009800_5
NC_010468_1
NC_010468_2
NC_010468_3
NC_010473_4
NC_011415_4
NC_011740_1
NC_011740_2
NC_011748_4
NC_011751_7
NC_012759_4
NC_013353_3
NC_016902_2
NC_017625_3
NC_017635_4
NC_017638_4
NC_017641_4
NC_017660_2
NC_017664_4
NC_018650_1
NC_018658_1
NC_018661_1
NC_020163_5
NC_020518_4
NC_022364_3
NZ_AKBV01000001_4
NZ_AKVX01000001_4
NZ_CM000960_4
NZ_CM001471_2
NZ_CP006027_4
NZ_CP006262_4
NZ_CP007133_4
NZ_CP007136_4
NZ_CP007392_2
NZ_CP007393_2
NZ_CP007394_2
NZ_CP007442_5
NZ_CP007491_5
NZ_CP007592_4
NZ_CP007592_5
NZ_CP008697_2
NZ_CP008801_4
NZ_CP009273_4
NZ_CP009644_4
NZ_CP009685_3
NZ_CP009789_4
NZ_CP009859_2
NZ_CP010315_4
NZ_CP010371_4
NZ_CP010438_4
NZ_CP010439_4
NZ_CP010440_4
NZ_CP010441_4
NZ_CP010442_4
NZ_CP010443_4
NZ_CP010444_4
NZ_CP010445_4
NZ_CP011061_4
NZ_CP011113_4
NZ_CP011134_3
NZ_CP011320_4
NZ_CP011321_4
NZ_CP011324_4
NZ_CP011331_1
NZ_CP011342_3
NZ_CP011343_5
NZ_CP011416_2
NZ_CP011495_4
NZ_CP012125_4
NZ_CP012126_4
NZ_CP012127_4
NZ_CP012868_3
NZ_CP012869_3
NZ_CP012870_3
NZ_CP013112_4
NZ_CP013190_2
NZ_CP013483_2
NZ_CP014225_2
NZ_CP014270_4
NZ_CP014272_4
NZ_CP014348_6
NZ_CP015240_3
NZ_CP015834_2
NZ_CP016018_3
NZ_CP017100_4
NZ_HF572917_4
NZ_HG738867_6
NZ_LM993812_4
NZ_LM995446_4
NZ_LN832404_4
NZ_LT601384_8
CGGTTTATCCCCGCTGGCGCGGGGAACTC
29

NC_000913_5
NC_007779_5
NC_010473_5
NC_012759_5
NC_017625_2
NC_017638_5
NC_017641_5
NC_020518_5
NZ_AKBV01000001_5
NZ_AKVX01000001_5
NZ_AP014951_2
NZ_CM000960_5
NZ_CP008801_5
NZ_CP009273_5
NZ_CP009644_5
NZ_CP009685_2
NZ_CP009789_5
NZ_CP010371_5
NZ_CP010438_5
NZ_CP010439_5
NZ_CP010440_5
NZ_CP010441_5
NZ_CP010442_5
NZ_CP010443_5
NZ_CP010444_5
NZ_CP010445_5
NZ_CP011113_5
NZ_CP011134_4
NZ_CP011320_5
NZ_CP011321_5
NZ_CP011324_5
NZ_CP011342_4
NZ_CP011343_6
NZ_CP011495_5
NZ_CP012125_5
NZ_CP012126_5
NZ_CP012127_5
NZ_CP012868_2
NZ_CP012869_2
NZ_CP012870_2
NZ_CP013253_2
NZ_CP014225_3
NZ_CP014270_5
NZ_CP014272_5
NZ_CP014348_5
NZ_CP014583_9
NZ_CP014670_2
NZ_CP016018_2
NZ_CP016404_5
NZ_CP017100_5
NZ_HG738867_5
NZ_LM993812_5
NZ_LM995446_5
NZ_LN832404_5
GGTTTATCCCCGCTGGCGCGGGGAACAC
28

NC_000916_16
NC_000916_7
NC_014408_3
NZ_AP011952_21
NZ_AP011952_9
GTTAAAATCAGACCAAAATGGGATTGAAAT
30

NC_000917_1
NC_000917_2
NZ_CP006577_1
NZ_CP006577_2
GTTGAAATCAGACCAAAATGGGATTGAAAG
30

NC_000917_3
NZ_CP006577_6
GTAAGAAAGGGAGGCTCCTGAAAATGGAGATTGAAAG
37

NC_000918_1
NC_000918_10
NC_000918_2
NC_000918_3
NC_000918_6
GTTCCTAATGTACCGTGTGGAGTTGAAAC
29

NC_000918_4
GTTTTAACTCCACACGGTACATTAGAAAC
29

NC_000918_5
GTCGCAATCCCTCACTATTAGGGCGTAAC
29

NC_000918_7
GTTTCTAATGTACCGTAGAGGAGTTGAAAC
30

NC_000918_8
NC_013894_2
NC_013894_3
NC_013894_4
NC_013894_6
GTTTCTAATGTACCGTGTGGAGTTGAAAG
29

NC_000918_9
GTTTCAACTCCACTACGGTACATTAGGAAC
30

NC_000961_1
NC_000961_2
NC_000961_4
NZ_CP010835_3
NZ_CP010835_8
NZ_LN999010_2
NZ_LN999010_6
NZ_LN999010_8
CTTTCCACACTATTTAGTTCTACGGAAAC
29

NC_000961_3
GTTCCAATAAGACTATAAGAGAATTGAAAG
30

NC_000961_5
GTTCCAATAAGACTAAAATAGAATTGAAAC
30

NC_000962_5
NC_000962_6
NC_002755_5
NC_002755_6
NC_002945_4
NC_002945_5
NC_008769_3
NC_008769_4
NC_009525_5
NC_009525_6
NC_009565_5
NC_009565_6
NC_012207_3
NC_012207_4
NC_012943_2
NC_012943_3
NC_015758_4
NC_015758_5
NC_015848_5
NC_016768_2
NC_016768_3
NC_016804_3
NC_016804_4
NC_016934_6
NC_016934_7
NC_016934_8
NC_016934_9
NC_017026_6
NC_017026_7
NC_017026_8
NC_017522_4
NC_017523_5
NC_017524_6
NC_017524_8
NC_017528_6
NC_017528_7
NC_017528_8
NC_018078_2
NC_018078_3
NC_018143_5
NC_018143_6
NC_019950_7
NC_020089_4
NC_020245_3
NC_020245_4
NC_020559_4
NC_020559_5
NC_021054_7
NC_021054_8
NC_021192_10
NC_021192_9
NC_021193_6
NC_021193_7
NC_021194_5
NC_021194_6
NC_021251_4
NC_021740_5
NC_021740_6
NC_022350_4
NC_022350_5
NC_022350_6
NZ_AM412059_3
NZ_AM412059_4
NZ_AP014573_3
NZ_AP014573_5
NZ_CM000787_3
NZ_CM000787_4
NZ_CM000788_5
NZ_CM000788_6
NZ_CM000789_4
NZ_CM000789_5
NZ_CM001043_5
NZ_CM001044_3
NZ_CM001045_4
NZ_CM001225_3
NZ_CM001225_4
NZ_CM001226_5
NZ_CM001226_6
NZ_CM001227_4
NZ_CM001227_5
NZ_CM001227_6
NZ_CM001227_7
NZ_CM001515_4
NZ_CM001515_5
NZ_CM002022_4
NZ_CM002022_5
NZ_CM002048_4
NZ_CM002048_5
NZ_CM002048_6
NZ_CM002048_7
NZ_CM002049_4
NZ_CM002049_5
NZ_CM002050_3
NZ_CM002050_4
NZ_CM002051_3
NZ_CM002051_4
NZ_CM002052_3
NZ_CM002052_4
NZ_CM002052_5
NZ_CM002053_5
NZ_CM002053_6
NZ_CM002054_3
NZ_CM002055_4
NZ_CM002056_3
NZ_CM002056_4
NZ_CM002057_3
NZ_CM002057_4
NZ_CM002058_3
NZ_CM002058_4
NZ_CM002059_4
NZ_CM002059_5
NZ_CM002060_3
NZ_CM002060_4
NZ_CM002061_4
NZ_CM002061_5
NZ_CM002062_3
NZ_CM002062_4
NZ_CM002063_4
NZ_CM002063_5
NZ_CM002064_4
NZ_CM002064_5
NZ_CM002065_4
NZ_CM002065_5
NZ_CM002066_4
NZ_CM002066_5
NZ_CM002067_3
NZ_CM002067_4
NZ_CM002069_4
NZ_CM002070_6
NZ_CM002071_3
NZ_CM002073_3
NZ_CM002073_4
NZ_CM002074_6
NZ_CM002074_7
NZ_CM002075_6
NZ_CM002075_7
NZ_CM002076_3
NZ_CM002077_6
NZ_CM002077_7
NZ_CM002078_3
NZ_CM002078_4
NZ_CM002078_5
NZ_CM002079_3
NZ_CM002079_4
NZ_CM002080_4
NZ_CM002080_5
NZ_CM002097_4
NZ_CM002097_5
NZ_CM002098_3
NZ_CM002098_4
NZ_CM002098_5
NZ_CM002098_6
NZ_CM002099_4
NZ_CM002099_5
NZ_CM002100_3
NZ_CM002100_4
NZ_CM002101_4
NZ_CM002101_5
NZ_CM002102_3
NZ_CM002102_4
NZ_CM002103_4
NZ_CM002104_3
NZ_CM002104_4
NZ_CM002105_4
NZ_CM002105_5
NZ_CM002106_4
NZ_CM002106_5
NZ_CM002107_3
NZ_CM002107_4
NZ_CM002108_3
NZ_CM002108_4
NZ_CM002109_3
NZ_CM002109_4
NZ_CM002109_5
NZ_CM002109_6
NZ_CM002110_5
NZ_CM002111_5
NZ_CM002111_6
NZ_CM002112_4
NZ_CM002112_5
NZ_CM002113_3
NZ_CM002113_4
NZ_CM002113_5
NZ_CM002114_4
NZ_CM002115_4
NZ_CM002115_5
NZ_CM002115_6
NZ_CM002115_7
NZ_CM002116_4
NZ_CM002116_5
NZ_CM002117_3
NZ_CM002117_4
NZ_CM002118_4
NZ_CM002118_5
NZ_CM002119_6
NZ_CM002120_3
NZ_CM002120_4
NZ_CM002121_4
NZ_CM002121_5
NZ_CM002122_3
NZ_CM002122_4
NZ_CM002123_3
NZ_CM002124_5
NZ_CM002125_3
NZ_CM002125_4
NZ_CM002126_6
NZ_CM002126_7
NZ_CM002127_4
NZ_CM002127_5
NZ_CM002882_3
NZ_CM002882_4
NZ_CM002883_3
NZ_CM002883_4
NZ_CM002884_3
NZ_CM002884_4
NZ_CP002871_3
NZ_CP002882_3
NZ_CP002883_3
NZ_CP002885_3
NZ_CP003494_5
NZ_CP003494_6
NZ_CP003494_7
NZ_CP007027_3
NZ_CP007027_4
NZ_CP007299_3
NZ_CP007803_3
NZ_CP007809_3
NZ_CP008744_3
NZ_CP008744_4
NZ_CP009100_3
NZ_CP009100_4
NZ_CP009101_3
NZ_CP009101_4
NZ_CP009243_3
NZ_CP009243_4
NZ_CP009426_3
NZ_CP009427_4
NZ_CP009427_5
NZ_CP009449_3
NZ_CP009449_4
NZ_CP009449_5
NZ_CP009480_3
NZ_CP009480_4
NZ_CP010330_3
NZ_CP010330_4
NZ_CP010337_3
NZ_CP010337_4
NZ_CP010338_3
NZ_CP010339_3
NZ_CP010339_4
NZ_CP010340_3
NZ_CP010340_4
NZ_CP010968_7
NZ_CP011455_3
NZ_CP011455_4
NZ_CP011455_5
NZ_CP011510_1
NZ_CP011510_2
NZ_CP012090_3
NZ_CP012095_3
NZ_CP012095_4
NZ_CP012506_4
NZ_CP013475_3
NZ_CP013741_3
NZ_CP013741_4
NZ_CP014566_3
NZ_CP014566_4
NZ_CP014617_7
NZ_CP016794_7
NZ_CP016888_3
NZ_HG813240_4
GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC
36

NC_001880_1
CTTTCTATCCCATATATGGGAACTAAAAC
29

NC_002163_2
NC_003912_2
NC_009707_3
NC_009839_2
NC_014802_2
NC_017279_2
NC_017280_2
NC_018521_2
NC_018709_2
NC_022353_2
NC_022529_2
NZ_CP006685_2
NZ_CP006686_2
NZ_CP006687_2
NZ_CP006688_2
NZ_CP006689_2
NZ_CP007181_1
NZ_CP008787_2
NZ_CP010307_2
NZ_CP012149_2
NZ_CP012696_2
NZ_CP014344_2
NZ_CP015209_2
NZ_CP017025_1
NZ_CP017029_1
NZ_CP017031_2
NZ_CP017456_2
NZ_CP017871_1
NZ_CP017875_1
NZ_CP017875_2
GTTTTAGTCCCTTTTTAAATTTCTTTATGGTAAAAT
36

NC_002570_1
NZ_CP016784_3
NZ_CP016784_4
NZ_CP016784_5
GTCGCACTCTACATGAGTGCGTGGATTGAAAT
32

NC_002570_2
GTCGCACTCTACACGAGTGCGTGGATTGAAAT
32

NC_002570_3
NC_002570_4
GTCGCACTCTTCATGGGTGCGTGGATTGAAAT
32

NC_002570_5
GTCGCACTCTATATGGGTGCGTGGATTGAAAT
32

NC_002578_2
GTAAAATAGAACCTTAATAGGATTGAAAG
29

NC_002655_2
NC_002695_3
NC_003197_2
NC_003197_3
NC_003197_4
NC_003198_1
NC_004631_1
NC_006511_2
NC_006511_3
NC_006905_1
NC_006905_2
NC_009801_2
NC_009801_3
NC_011080_1
NC_011080_2
NC_011083_2
NC_011083_3
NC_011083_4
NC_011094_1
NC_011094_2
NC_011147_2
NC_011147_3
NC_011149_1
NC_011149_2
NC_011205_2
NC_011274_2
NC_011294_1
NC_011294_2
NC_011353_2
NC_011415_3
NC_011741_3
NC_011741_4
NC_011748_3
NC_011751_6
NC_012125_1
NC_012125_2
NC_012880_4
NC_012892_4
NC_012892_5
NC_012947_1
NC_012947_2
NC_012967_4
NC_012967_5
NC_012971_4
NC_012971_5
NC_013008_2
NC_013282_3
NC_013353_2
NC_013361_1
NC_013361_2
NC_013364_1
NC_013364_2
NC_013421_1
NC_013421_2
NC_013716_10
NC_015761_1
NC_015761_2
NC_016612_1
NC_016810_2
NC_016810_3
NC_016810_4
NC_016822_5
NC_016832_2
NC_016854_2
NC_016854_3
NC_016854_4
NC_016856_2
NC_016856_3
NC_016856_4
NC_016857_2
NC_016857_3
NC_016857_4
NC_016860_2
NC_016860_3
NC_016860_4
NC_016863_2
NC_016863_3
NC_016863_4
NC_016902_3
NC_017046_2
NC_017046_3
NC_017623_2
NC_017623_3
NC_017623_4
NC_017633_7
NC_017635_3
NC_017660_3
NC_017663_8
NC_017663_9
NC_017664_3
NC_017906_2
NC_017910_2
NC_018106_2
NC_018525_1
NC_018525_2
NC_018650_2
NC_018658_2
NC_018661_2
NC_020307_1
NC_020307_2
NC_021810_1
NC_021810_2
NC_021810_3
NC_021812_2
NC_021812_3
NC_021812_4
NC_021814_2
NC_021814_3
NC_021814_4
NC_021818_2
NC_021818_3
NC_021820_1
NC_021820_2
NC_021820_3
NC_021844_3
NC_021844_4
NC_021870_2
NC_021870_3
NC_021902_1
NC_021902_2
NC_022241_1
NC_022241_2
NC_022364_2
NC_022525_1
NC_022525_2
NC_022544_2
NC_022544_3
NC_022544_4
NC_022569_2
NC_022569_3
NC_022991_1
NC_022991_2
NZ_AGTD01000001_4
NZ_AGTD01000001_5
NZ_AGTD01000001_6
NZ_AP014565_2
NZ_AP014565_3
NZ_AP014565_4
NZ_AP014950_3
NZ_CM000662_3
NZ_CM001062_1
NZ_CM001062_2
NZ_CM001142_2
NZ_CM001142_3
NZ_CM001151_2
NZ_CM001153_2
NZ_CM001274_1
NZ_CM001274_2
NZ_CM001857_5
NZ_CM001858_1
NZ_CM001858_2
NZ_CM001972_1
NZ_CM001972_11
NZ_CM001972_2
NZ_CM001972_3
NZ_CM001972_4
NZ_CM001975_1
NZ_CM001975_2
NZ_CM001977_2
NZ_CM001977_3
NZ_CM001978_2
NZ_CM001978_3
NZ_CM001978_4
NZ_CM001978_5
NZ_CM001979_1
NZ_CM001979_2
NZ_CM001979_3
NZ_CM001983_1
NZ_CM001983_2
NZ_CM001984_1
NZ_CM001984_2
NZ_CM001984_3
NZ_CM001984_4
NZ_CM001985_2
NZ_CM001985_3
NZ_CP004887_2
NZ_CP005995_2
NZ_CP005995_3
NZ_CP005995_4
NZ_CP006636_3
NZ_CP006692_1
NZ_CP006692_2
NZ_CP006929_2
NZ_CP006929_3
NZ_CP007175_1
NZ_CP007175_2
NZ_CP007211_2
NZ_CP007211_3
NZ_CP007216_1
NZ_CP007216_2
NZ_CP007222_1
NZ_CP007222_2
NZ_CP007235_2
NZ_CP007235_3
NZ_CP007245_1
NZ_CP007245_2
NZ_CP007246_1
NZ_CP007246_2
NZ_CP007247_1
NZ_CP007247_2
NZ_CP007248_1
NZ_CP007248_2
NZ_CP007249_1
NZ_CP007249_2
NZ_CP007250_1
NZ_CP007250_2
NZ_CP007252_1
NZ_CP007252_2
NZ_CP007253_1
NZ_CP007253_2
NZ_CP007254_1
NZ_CP007254_2
NZ_CP007258_1
NZ_CP007258_2
NZ_CP007259_1
NZ_CP007259_2
NZ_CP007260_1
NZ_CP007260_2
NZ_CP007261_1
NZ_CP007261_2
NZ_CP007262_1
NZ_CP007262_2
NZ_CP007263_1
NZ_CP007263_2
NZ_CP007265_7
NZ_CP007265_8
NZ_CP007266_1
NZ_CP007266_2
NZ_CP007267_1
NZ_CP007267_2
NZ_CP007269_1
NZ_CP007269_2
NZ_CP007271_1
NZ_CP007271_2
NZ_CP007272_1
NZ_CP007272_2
NZ_CP007273_1
NZ_CP007273_2
NZ_CP007274_1
NZ_CP007274_2
NZ_CP007277_1
NZ_CP007277_2
NZ_CP007278_1
NZ_CP007278_2
NZ_CP007279_1
NZ_CP007279_2
NZ_CP007280_1
NZ_CP007280_2
NZ_CP007281_1
NZ_CP007281_2
NZ_CP007282_1
NZ_CP007282_2
NZ_CP007283_1
NZ_CP007283_2
NZ_CP007284_1
NZ_CP007284_2
NZ_CP007285_1
NZ_CP007285_2
NZ_CP007286_1
NZ_CP007286_2
NZ_CP007288_1
NZ_CP007288_2
NZ_CP007289_1
NZ_CP007289_2
NZ_CP007290_1
NZ_CP007290_2
NZ_CP007291_1
NZ_CP007291_2
NZ_CP007292_1
NZ_CP007292_2
NZ_CP007293_1
NZ_CP007293_2
NZ_CP007294_1
NZ_CP007294_2
NZ_CP007295_1
NZ_CP007295_2
NZ_CP007296_1
NZ_CP007296_2
NZ_CP007297_1
NZ_CP007297_2
NZ_CP007298_1
NZ_CP007298_2
NZ_CP007300_1
NZ_CP007300_2
NZ_CP007301_1
NZ_CP007301_2
NZ_CP007302_1
NZ_CP007302_2
NZ_CP007303_1
NZ_CP007303_2
NZ_CP007304_1
NZ_CP007304_2
NZ_CP007305_1
NZ_CP007305_2
NZ_CP007306_1
NZ_CP007306_2
NZ_CP007307_1
NZ_CP007307_2
NZ_CP007308_1
NZ_CP007308_2
NZ_CP007309_1
NZ_CP007309_2
NZ_CP007310_1
NZ_CP007310_2
NZ_CP007311_1
NZ_CP007311_2
NZ_CP007312_1
NZ_CP007312_2
NZ_CP007313_1
NZ_CP007313_2
NZ_CP007314_1
NZ_CP007314_2
NZ_CP007315_1
NZ_CP007315_2
NZ_CP007316_1
NZ_CP007316_2
NZ_CP007317_1
NZ_CP007317_2
NZ_CP007318_1
NZ_CP007318_2
NZ_CP007319_1
NZ_CP007319_2
NZ_CP007320_1
NZ_CP007320_2
NZ_CP007321_1
NZ_CP007321_2
NZ_CP007322_1
NZ_CP007322_2
NZ_CP007323_1
NZ_CP007323_2
NZ_CP007324_1
NZ_CP007324_2
NZ_CP007325_1
NZ_CP007325_2
NZ_CP007326_1
NZ_CP007326_2
NZ_CP007327_1
NZ_CP007327_2
NZ_CP007328_1
NZ_CP007328_2
NZ_CP007329_1
NZ_CP007329_2
NZ_CP007330_1
NZ_CP007330_2
NZ_CP007331_1
NZ_CP007331_2
NZ_CP007332_1
NZ_CP007332_2
NZ_CP007333_1
NZ_CP007333_2
NZ_CP007334_1
NZ_CP007334_2
NZ_CP007335_1
NZ_CP007335_2
NZ_CP007336_1
NZ_CP007336_2
NZ_CP007337_1
NZ_CP007337_2
NZ_CP007338_1
NZ_CP007338_2
NZ_CP007339_1
NZ_CP007339_2
NZ_CP007340_1
NZ_CP007340_2
NZ_CP007341_1
NZ_CP007341_2
NZ_CP007342_1
NZ_CP007342_2
NZ_CP007343_1
NZ_CP007343_2
NZ_CP007344_1
NZ_CP007344_2
NZ_CP007345_1
NZ_CP007345_2
NZ_CP007346_1
NZ_CP007346_2
NZ_CP007347_1
NZ_CP007347_2
NZ_CP007348_1
NZ_CP007348_2
NZ_CP007349_1
NZ_CP007349_2
NZ_CP007350_1
NZ_CP007350_2
NZ_CP007351_1
NZ_CP007351_2
NZ_CP007352_1
NZ_CP007352_2
NZ_CP007353_1
NZ_CP007353_2
NZ_CP007354_1
NZ_CP007354_2
NZ_CP007355_1
NZ_CP007355_2
NZ_CP007356_1
NZ_CP007356_2
NZ_CP007357_1
NZ_CP007357_2
NZ_CP007358_1
NZ_CP007358_2
NZ_CP007359_1
NZ_CP007359_2
NZ_CP007360_1
NZ_CP007360_2
NZ_CP007361_1
NZ_CP007361_2
NZ_CP007362_1
NZ_CP007362_2
NZ_CP007363_1
NZ_CP007363_2
NZ_CP007364_1
NZ_CP007364_2
NZ_CP007365_1
NZ_CP007365_2
NZ_CP007366_1
NZ_CP007366_2
NZ_CP007367_1
NZ_CP007367_2
NZ_CP007368_1
NZ_CP007368_2
NZ_CP007369_1
NZ_CP007369_2
NZ_CP007370_1
NZ_CP007370_2
NZ_CP007371_1
NZ_CP007371_2
NZ_CP007372_1
NZ_CP007372_2
NZ_CP007373_1
NZ_CP007373_2
NZ_CP007374_1
NZ_CP007374_2
NZ_CP007375_1
NZ_CP007375_2
NZ_CP007376_1
NZ_CP007376_2
NZ_CP007377_1
NZ_CP007377_2
NZ_CP007378_1
NZ_CP007378_2
NZ_CP007379_1
NZ_CP007379_2
NZ_CP007380_1
NZ_CP007380_2
NZ_CP007381_1
NZ_CP007381_2
NZ_CP007382_1
NZ_CP007382_2
NZ_CP007383_1
NZ_CP007383_2
NZ_CP007384_1
NZ_CP007384_2
NZ_CP007385_1
NZ_CP007385_2
NZ_CP007386_1
NZ_CP007386_2
NZ_CP007387_1
NZ_CP007387_2
NZ_CP007388_1
NZ_CP007388_2
NZ_CP007390_1
NZ_CP007390_2
NZ_CP007391_1
NZ_CP007391_2
NZ_CP007395_1
NZ_CP007395_2
NZ_CP007396_1
NZ_CP007396_2
NZ_CP007397_1
NZ_CP007397_2
NZ_CP007398_1
NZ_CP007398_2
NZ_CP007400_1
NZ_CP007400_2
NZ_CP007401_1
NZ_CP007401_2
NZ_CP007402_1
NZ_CP007402_2
NZ_CP007403_1
NZ_CP007403_2
NZ_CP007404_1
NZ_CP007404_2
NZ_CP007405_1
NZ_CP007405_2
NZ_CP007406_1
NZ_CP007406_2
NZ_CP007407_1
NZ_CP007407_2
NZ_CP007408_1
NZ_CP007408_2
NZ_CP007411_1
NZ_CP007411_2
NZ_CP007412_1
NZ_CP007412_2
NZ_CP007413_1
NZ_CP007413_2
NZ_CP007414_1
NZ_CP007414_2
NZ_CP007415_1
NZ_CP007415_2
NZ_CP007416_1
NZ_CP007416_2
NZ_CP007417_1
NZ_CP007417_2
NZ_CP007418_1
NZ_CP007418_2
NZ_CP007419_1
NZ_CP007419_2
NZ_CP007420_1
NZ_CP007420_2
NZ_CP007421_1
NZ_CP007421_2
NZ_CP007422_1
NZ_CP007422_2
NZ_CP007423_1
NZ_CP007423_2
NZ_CP007424_1
NZ_CP007424_2
NZ_CP007425_1
NZ_CP007425_2
NZ_CP007426_1
NZ_CP007426_2
NZ_CP007427_1
NZ_CP007427_2
NZ_CP007428_1
NZ_CP007428_2
NZ_CP007429_1
NZ_CP007429_2
NZ_CP007430_1
NZ_CP007430_2
NZ_CP007431_1
NZ_CP007431_2
NZ_CP007432_1
NZ_CP007432_2
NZ_CP007433_1
NZ_CP007433_2
NZ_CP007434_1
NZ_CP007434_2
NZ_CP007438_1
NZ_CP007438_2
NZ_CP007463_1
NZ_CP007463_2
NZ_CP007464_1
NZ_CP007464_2
NZ_CP007465_1
NZ_CP007465_2
NZ_CP007466_1
NZ_CP007466_2
NZ_CP007467_1
NZ_CP007467_2
NZ_CP007468_1
NZ_CP007468_2
NZ_CP007469_1
NZ_CP007469_2
NZ_CP007483_1
NZ_CP007484_2
NZ_CP007484_3
NZ_CP007491_4
NZ_CP007498_1
NZ_CP007498_2
NZ_CP007505_1
NZ_CP007505_2
NZ_CP007507_1
NZ_CP007507_2
NZ_CP007523_2
NZ_CP007523_3
NZ_CP007523_4
NZ_CP007528_1
NZ_CP007528_2
NZ_CP007530_1
NZ_CP007530_2
NZ_CP007531_1
NZ_CP007531_2
NZ_CP007532_1
NZ_CP007532_2
NZ_CP007532_3
NZ_CP007533_1
NZ_CP007533_2
NZ_CP007534_1
NZ_CP007540_2
NZ_CP007540_3
NZ_CP007559_1
NZ_CP007559_2
NZ_CP007559_3
NZ_CP007581_2
NZ_CP007581_3
NZ_CP007584_1
NZ_CP007584_2
NZ_CP007594_7
NZ_CP007598_1
NZ_CP007598_2
NZ_CP007731_5
NZ_CP007804_2
NZ_CP007804_3
NZ_CP007804_4
NZ_CP008697_3
NZ_CP008805_2
NZ_CP008928_1
NZ_CP008928_2
NZ_CP008957_2
NZ_CP009049_5
NZ_CP009049_6
NZ_CP009083_1
NZ_CP009083_2
NZ_CP009084_1
NZ_CP009084_2
NZ_CP009085_1
NZ_CP009085_2
NZ_CP009086_1
NZ_CP009086_2
NZ_CP009087_1
NZ_CP009087_2
NZ_CP009088_1
NZ_CP009088_2
NZ_CP009089_1
NZ_CP009089_2
NZ_CP009090_1
NZ_CP009090_2
NZ_CP009091_1
NZ_CP009091_2
NZ_CP009092_1
NZ_CP009092_2
NZ_CP009093_1
NZ_CP009093_2
NZ_CP009102_2
NZ_CP009102_3
NZ_CP009102_4
NZ_CP009104_2
NZ_CP009104_3
NZ_CP009106_3
NZ_CP009106_4
NZ_CP009166_3
NZ_CP009166_4
NZ_CP009450_3
NZ_CP009559_2
NZ_CP009559_3
NZ_CP009561_1
NZ_CP009561_2
NZ_CP009578_4
NZ_CP009578_5
NZ_CP009768_1
NZ_CP009768_2
NZ_CP009859_3
NZ_CP009876_3
NZ_CP010279_1
NZ_CP010279_2
NZ_CP010280_1
NZ_CP010280_2
NZ_CP010281_1
NZ_CP010281_2
NZ_CP010282_1
NZ_CP010282_2
NZ_CP010283_1
NZ_CP010283_2
NZ_CP010284_1
NZ_CP010284_2
NZ_CP010304_2
NZ_CP010315_3
NZ_CP010344_5
NZ_CP010344_6
NZ_CP010557_1
NZ_CP010585_4
NZ_CP010585_5
NZ_CP010816_4
NZ_CP010816_5
NZ_CP011018_6
NZ_CP011018_7
NZ_CP011233_2
NZ_CP011233_3
NZ_CP011233_4
NZ_CP011259_1
NZ_CP011259_2
NZ_CP011288_1
NZ_CP011289_1
NZ_CP011292_1
NZ_CP011331_2
NZ_CP011365_1
NZ_CP011365_2
NZ_CP011394_1
NZ_CP011394_2
NZ_CP011396_2
NZ_CP011396_3
NZ_CP011428_1
NZ_CP011428_2
NZ_CP011428_3
NZ_CP011624_2
NZ_CP011642_1
NZ_CP011642_2
NZ_CP011790_1
NZ_CP011790_2
NZ_CP011791_1
NZ_CP011791_2
NZ_CP011938_4
NZ_CP011938_5
NZ_CP011942_1
NZ_CP011942_2
NZ_CP011967_3
NZ_CP012091_1
NZ_CP012144_3
NZ_CP012144_4
NZ_CP012151_3
NZ_CP012266_2
NZ_CP012268_3
NZ_CP012344_1
NZ_CP012344_2
NZ_CP012346_2
NZ_CP012349_1
NZ_CP012349_2
NZ_CP012396_1
NZ_CP012396_2
NZ_CP012426_2
NZ_CP012513_1
NZ_CP012513_2
NZ_CP012514_1
NZ_CP012514_2
NZ_CP012681_2
NZ_CP012681_3
NZ_CP012681_4
NZ_CP012693_2
NZ_CP012693_3
NZ_CP012743_1
NZ_CP012744_1
NZ_CP012745_1
NZ_CP012802_4
NZ_CP012833_3
NZ_CP012833_4
NZ_CP012921_2
NZ_CP012921_3
NZ_CP012921_4
NZ_CP012924_2
NZ_CP012924_3
NZ_CP012924_4
NZ_CP012930_2
NZ_CP012930_3
NZ_CP012930_4
NZ_CP012985_2
NZ_CP012985_3
NZ_CP013025_4
NZ_CP013031_4
NZ_CP013031_5
NZ_CP013048_1
NZ_CP013048_2
NZ_CP013097_1
NZ_CP013097_2
NZ_CP013190_1
NZ_CP013222_1
NZ_CP013226_2
NZ_CP013322_2
NZ_CP013662_7
NZ_CP013663_2
NZ_CP013663_3
NZ_CP014051_2
NZ_CP014051_3
NZ_CP014051_4
NZ_CP014092_4
NZ_CP014092_5
NZ_CP014197_2
NZ_CP014268_5
NZ_CP014268_6
NZ_CP014269_5
NZ_CP014269_6
NZ_CP014314_2
NZ_CP014356_2
NZ_CP014356_3
NZ_CP014356_4
NZ_CP014358_2
NZ_CP014358_3
NZ_CP014536_2
NZ_CP014536_3
NZ_CP014536_4
NZ_CP014583_10
NZ_CP014620_1
NZ_CP014621_1
NZ_CP014657_1
NZ_CP014657_2
NZ_CP014659_1
NZ_CP014661_1
NZ_CP014663_1
NZ_CP014664_2
NZ_CP014665_1
NZ_CP014665_2
NZ_CP014666_1
NZ_CP014666_2
NZ_CP014755_2
NZ_CP014768_5
NZ_CP014768_6
NZ_CP014965_2
NZ_CP014965_3
NZ_CP014965_4
NZ_CP014967_2
NZ_CP014967_3
NZ_CP014969_2
NZ_CP014969_3
NZ_CP014971_2
NZ_CP014971_3
NZ_CP014971_4
NZ_CP014975_2
NZ_CP014975_3
NZ_CP014977_2
NZ_CP014977_3
NZ_CP014977_4
NZ_CP014979_2
NZ_CP014979_3
NZ_CP014981_2
NZ_CP014981_3
NZ_CP014981_4
NZ_CP014982_2
NZ_CP014982_3
NZ_CP014982_4
NZ_CP014983_2
NZ_CP014983_3
NZ_CP014983_4
NZ_CP014994_2
NZ_CP014994_3
NZ_CP014996_1
NZ_CP014996_2
NZ_CP015020_3
NZ_CP015023_1
NZ_CP015024_1
NZ_CP015024_2
NZ_CP015025_2
NZ_CP015157_2
NZ_CP015157_3
NZ_CP015157_4
NZ_CP015228_3
NZ_CP015228_4
NZ_CP015229_4
NZ_CP015240_2
NZ_CP015500_1
NZ_CP015724_2
NZ_CP015724_3
NZ_CP015749_6
NZ_CP015749_7
NZ_CP015750_4
NZ_CP015750_5
NZ_CP015834_3
NZ_CP015842_2
NZ_CP015843_2
NZ_CP015846_2
NZ_CP015855_3
NZ_CP015912_2
NZ_CP015912_3
NZ_CP015995_2
NZ_CP015995_3
NZ_CP016034_3
NZ_CP016034_4
NZ_CP016182_1
NZ_CP016182_2
NZ_CP016385_2
NZ_CP016385_3
NZ_CP016385_4
NZ_CP016404_4
NZ_CP016504_2
NZ_CP016504_3
NZ_CP016504_4
NZ_CP016507_2
NZ_CP016507_3
NZ_CP016507_4
NZ_CP016510_2
NZ_CP016510_3
NZ_CP016510_4
NZ_CP016514_2
NZ_CP016514_3
NZ_CP016514_4
NZ_CP016517_2
NZ_CP016517_3
NZ_CP016517_4
NZ_CP016521_2
NZ_CP016521_3
NZ_CP016521_4
NZ_CP016525_2
NZ_CP016525_3
NZ_CP016525_4
NZ_CP016530_2
NZ_CP016530_3
NZ_CP016530_4
NZ_CP016546_5
NZ_CP016546_6
NZ_CP016561_2
NZ_CP016561_3
NZ_CP016561_4
NZ_CP016563_2
NZ_CP016563_3
NZ_CP016563_4
NZ_CP016565_2
NZ_CP016565_3
NZ_CP016565_4
NZ_CP016569_2
NZ_CP016569_3
NZ_CP016569_4
NZ_CP016573_2
NZ_CP016573_3
NZ_CP016573_4
NZ_CP016576_2
NZ_CP016576_3
NZ_CP016576_4
NZ_CP016579_2
NZ_CP016579_3
NZ_CP016579_4
NZ_CP016581_2
NZ_CP016581_3
NZ_CP016581_4
NZ_CP016586_2
NZ_CP016586_3
NZ_CP016586_4
NZ_CP016625_2
NZ_CP016889_5
NZ_CP017249_2
NZ_CP017251_2
NZ_CP017434_2
NZ_CP017436_2
NZ_CP017438_2
NZ_CP017440_2
NZ_CP017442_2
NZ_CP017444_2
NZ_CP017446_2
NZ_CP017669_2
NZ_CP017723_2
NZ_CP017723_3
NZ_CP017727_3
NZ_CP017727_4
NZ_CP017728_2
NZ_CP017728_3
NZ_CP017728_4
NZ_FO834906_1
NZ_FO834906_2
NZ_HF572917_3
NZ_LN649235_1
NZ_LN649235_2
NZ_LN824133_2
NZ_LN868944_1
NZ_LN868944_2
NZ_LN868944_3
NZ_LN890518_1
NZ_LN890518_2
NZ_LN890520_1
NZ_LN890520_2
NZ_LN890522_1
NZ_LN890522_2
NZ_LN890524_1
NZ_LN890524_2
NZ_LN999997_2
NZ_LN999997_3
NZ_LN999997_4
NZ_LT571437_3
NZ_LT571437_4
NZ_LT601384_9
CGGTTTATCCCCGCTGGCGCGGGGAACAC
29

NC_002663_1
NC_016808_1
NZ_CM001580_1
NZ_CM001581_1
NZ_CM002276_2
NZ_CP003328_1
NZ_CP004392_5
NZ_CP006976_1
NZ_CP007205_1
NZ_CP008918_2
NZ_CP014618_1
GTTCACCATCGTGTAGATGGCTTAGAAA
28

NC_002663_3
NZ_CM001580_2
GTTGTAGTTCCCTCTCTCATTTCGCAGTGCTACAAT
36

NC_002663_4
NC_002663_5
NC_016808_2
NC_017027_3
NC_017764_3
NZ_CM001580_3
NZ_CM001581_5
NZ_CM002276_1
NZ_CP003328_2
NZ_CP006976_3
NZ_CP008918_1
NZ_CP014618_2
GTTAACTGCCGTATAGGCAGCTTAGAAA
28

NC_002689_1
NC_002689_2
CTTCCATACTAACTAGTACATCTTAAAC
28

NC_002737_1
NC_007296_2
NC_007297_1
NC_008022_1
NC_011375_1
NC_017053_1
NC_018936_1
NZ_AFRY01000001_3
NZ_AP014585_1
NZ_CP007023_1
NZ_CP007240_1
NZ_CP007241_1
NZ_CP007562_2
NZ_CP008776_4
NZ_CP011068_2
NZ_CP011069_2
NZ_CP011535_2
NZ_CP012045_1
NZ_CP013838_2
NZ_CP013839_2
NZ_CP014027_5
NZ_HG316453_2
GTTTTAGAGCTATGCTGTTTTGAATGGTCCCAAAAC
36

NC_002737_4
NC_007296_3
NC_007297_4
NC_008021_2
NC_008022_3
NC_008023_2
NC_008024_2
NC_011375_3
NC_018936_4
NZ_AFRY01000001_1
NZ_CP007241_3
NZ_CP007537_1
NZ_CP007561_1
NZ_CP013838_4
NZ_CP014138_2
NZ_CP014278_2
NZ_HG316453_4
ATTTCAATCCACTCACCCATGAAGGGTGAGAC
32

NC_002745_11
NC_002758_10
NC_002952_6
NC_009487_9
NC_009632_9
NC_009782_10
NC_013450_9
NC_017340_10
NC_017343_8
NZ_AP017320_8
NZ_CP009554_7
NZ_CP010526_8
NZ_CP010890_10
NZ_CP011147_10
NZ_CP011685_10
NZ_CP012593_12
NZ_CP012692_12
NZ_CP012976_9
NZ_CP013953_12
NZ_CP013955_12
NZ_CP014064_4
NZ_CP015173_3
NZ_LT009690_9
TCTATGTTGGGGCCCCGCCAACTTG
25

NC_002745_5
NC_002758_4
NC_009487_4
NC_009632_4
NC_009782_4
NC_013450_5
NC_017340_5
NC_017343_3
NZ_AP017320_4
NZ_CP010890_5
NZ_CP011147_4
NZ_CP011685_4
NZ_CP012593_6
NZ_CP012974_3
NZ_CP012976_3
NZ_CP013953_7
NZ_CP013955_7
NZ_CP014064_1
NZ_CP015173_8
CAGCTTCTGTGTTGGGGCCCCGC
23

NC_002754_10
NC_002754_11
NC_012622_1
NC_012622_2
NC_012623_3
NC_012623_4
NC_017275_1
NC_017275_2
NC_017276_2
NC_017276_3
NC_017276_4
NC_021058_1
NC_021058_2
NC_021058_3
NZ_LT549890_11
NZ_LT549890_12
CTTTCAATTCTATAGTAGATTAGC
24

NC_002754_3
NC_002754_4
NC_017274_7
NC_017274_8
NZ_CP011055_7
NZ_CP011055_8
NZ_CP011056_7
NZ_CP011056_8
NZ_CP011057_7
NZ_CP011057_8
NZ_LT549890_3
NZ_LT549890_4
GATTAATCCCAAAAGGAATTGAAAG
25

NC_002754_5
NC_002754_6
NC_017274_9
NZ_CP011055_9
NZ_CP011056_9
NZ_CP011057_9
NZ_LT549890_5
NZ_LT549890_6
NZ_LT549890_7
CTTTCAATTCTATAAGAGATTATC
24

NC_002754_9
NC_012588_2
NC_012588_3
NC_012632_2
NC_012632_3
NC_012726_1
NC_012726_2
NC_013769_1
NC_015518_7
NC_015518_8
NC_017274_12
NZ_AHJK01000001_1
NZ_AHJK01000001_2
NZ_AHJO01000001_2
NZ_AHJO01000001_3
NZ_AHJQ01000001_1
NZ_AHJQ01000001_2
NZ_AHJR01000001_1
NZ_AHJR01000001_2
NZ_AHJT01000001_2
NZ_AHJT01000001_3
NZ_CP011055_12
NZ_CP011056_12
NZ_CP011057_12
NZ_LT549890_10
GATAATCTACTATAGAATTGAAAG
24

NC_002932_1
GTTTCAATCCACGCGCCCGCGCGGGGCGCGAC
32

NC_002932_4
NZ_CP010415_1
NZ_CP017305_7
GTCTTCCCCACGCCCGTGGGGGTGTTTC
28

NC_002935_1
GAAGTCTATCAGGGTTTTTGAGAACTGAACCCCAGT
36

NC_002935_4
NC_016782_4
NC_016786_4
GTCTTCTCCGCACACGCGGAGGTATTTCC
29

NC_002939_1
GTATTCCGGGGCCATGATGCCCCGGCCTCATTGAAGC
37

NC_002939_4
NC_008609_2
NC_017454_2
NZ_CP010430_2
NZ_CP010430_3
NZ_CP010430_4
NZ_CP014963_2
NZ_HG322949_8
GTGTTCCCCGCATGCGCGGGGATGAACCG
29

NC_003112_5
NC_008767_6
NC_010120_3
NC_010120_4
NC_010120_6
NC_011035_1
NC_011035_2
NC_013016_3
NC_017512_10
NC_017513_6
NC_017514_3
NC_017515_13
NC_017515_14
NC_017516_5
NC_017516_6
NC_017517_8
NC_017518_4
NC_022240_1
NZ_CP006869_3
NZ_CP006869_4
NZ_CP007524_13
NZ_CP009418_4
NZ_CP009419_5
NZ_CP009419_6
NZ_CP009419_7
NZ_CP009420_4
NZ_CP009420_5
NZ_CP009421_3
NZ_CP009421_4
NZ_CP009422_5
NZ_CP009422_6
NZ_CP009422_7
NZ_CP012026_8
NZ_CP012027_3
NZ_CP012027_4
NZ_CP012028_7
NZ_CP012391_8
NZ_CP012392_1
NZ_CP012392_11
NZ_CP012393_3
NZ_CP012393_4
NZ_CP012393_5
NZ_CP012394_5
NZ_CP012394_6
NZ_CP012394_7
NZ_CP012694_19
NZ_CP016015_1
NZ_CP016016_1
NZ_CP016017_1
NZ_CP016627_3
NZ_CP016627_4
NZ_CP016644_3
NZ_CP016644_4
NZ_CP016644_5
NZ_CP016645_6
NZ_CP016645_7
NZ_CP016648_3
NZ_CP016648_4
NZ_CP016649_5
NZ_CP016649_6
NZ_CP016649_7
NZ_CP016649_8
NZ_CP016649_9
NZ_CP016650_4
NZ_CP016650_5
NZ_CP016652_4
NZ_CP016652_5
NZ_CP016653_10
NZ_CP016653_8
NZ_CP016653_9
NZ_CP016655_4
NZ_CP016655_5
NZ_CP016656_4
NZ_CP016656_5
NZ_CP016657_4
NZ_CP016657_5
NZ_CP016659_3
NZ_CP016659_4
NZ_CP016659_5
NZ_CP016663_4
NZ_CP016663_5
NZ_CP016664_6
NZ_CP016665_7
NZ_CP016665_8
NZ_CP016665_9
NZ_CP016668_7
NZ_CP016669_5
NZ_CP016669_6
NZ_CP016669_7
NZ_CP016673_6
NZ_CP016674_4
NZ_CP016674_5
NZ_CP016674_6
NZ_CP016674_7
NZ_CP016674_8
NZ_CP016675_10
NZ_CP016675_11
NZ_CP016675_9
NZ_CP016677_6
NZ_CP016678_5
NZ_CP016678_6
NZ_CP016678_7
NZ_CP016679_4
NZ_CP016679_5
NZ_CP016681_7
NZ_CP016681_8
NZ_CP016681_9
NZ_CP016683_5
NZ_CP016683_6
NZ_CP016684_5
NZ_CP016684_6
NZ_CP016684_7
NZ_CP016880_6
NZ_CP016880_7
NZ_CP016880_8
NZ_CP016881_4
NZ_CP016881_5
NZ_CP016882_4
NZ_CP016882_5
NZ_CP016884_7
NZ_CP016884_8
NZ_CP016885_8
NZ_CP016886_9
CCGTCATTCCCGCGCAGGCGGGAATC
26

NC_002946_2
NC_022240_3
NZ_CP012026_3
NZ_CP012027_2
NZ_CP016017_2
GATTCCCGCCTGTGCGGGAATGACGG
26

NC_002946_3
NC_003112_2
NC_017516_1
NZ_CP006869_8
GATTCCCACTTTCGCGGGAATGACG
25

NC_002946_5
NC_011035_3
NC_011035_4
NC_011035_5
NC_011035_9
NZ_CP012026_4
NZ_CP012026_5
NZ_CP012026_6
GGATTCCCGCTTTCGCGGGAATGACG
26

NC_002950_1
NC_010729_8
NC_015571_9
NZ_CP011995_4
NZ_CP011996_5
NZ_CP012889_7
NZ_CP013131_3
GTTGGATCTACCCTCTATTCGAAGGGTACACACAAC
36

NC_002950_2
NC_010729_5
NZ_CP007756_7
NZ_CP012889_5
GTTGTCTCCACCCTTCTAACTAAGGGTATTCCCAAC
36

NC_002950_5
NC_010729_10
NC_015571_4
NZ_CP011995_5
NZ_CP011995_6
NZ_CP012889_9
NZ_CP013131_8
GTCTTAATAGCCTTACGGACTGTGTATGTATAGTGAG
37

NC_002950_6
NC_010729_12
NC_015571_5
NC_015571_6
NC_015571_7
NZ_CP007756_4
NZ_CP011995_7
NZ_CP012889_11
NZ_CP013131_6
NZ_CP013131_7
GTTTTAATTCCTGTATGGTGCAATTGAAAT
30

NC_002951_4
NC_002953_2
NC_003923_3
NC_017331_4
NC_021670_4
NC_022604_4
NZ_CP007539_4
NZ_CP007674_3
NZ_CP009681_4
NZ_CP011526_4
NZ_CP012011_4
NZ_CP012012_3
NZ_CP012013_4
NZ_CP012015_4
NZ_CP012018_4
NZ_CP012970_1
NZ_CP012972_1
NZ_CP012978_1
NZ_CP012979_2
NZ_CP013957_4
NZ_CP013959_4
TTCTTTATGTTGGGGCCCCGCCAACT
26

NC_002951_6
NC_007793_6
NC_007795_6
NC_009641_7
NC_010079_7
NC_016912_6
NC_017347_9
NZ_CP007176_7
NZ_CP007670_5
NZ_CP007672_5
NZ_CP007674_8
NZ_CP007676_6
NZ_CP007690_7
NZ_CP010295_6
NZ_CP010296_6
NZ_CP010297_6
NZ_CP010298_6
NZ_CP010299_6
NZ_CP010300_6
NZ_CP011526_8
NZ_CP012119_7
NZ_CP012120_6
NZ_CP013231_2
NZ_LT598688_6
TGTTGGGGCCCCGCCAACCTGCA
23

NC_002967_1
GTTTGAGAGTTGTGTAATTTAAGATGGATCTCAAAC
36

NC_002976_2
GTTCTCGTCCCCTTTTCTTCGGGGTGGGTATCGATCC
37

NC_002977_1
GTTTCAATCCACTCCCGGCTATTTAGCCGGGAGATAC
37

NC_002977_2
GGTCTATCCCCGCGTGTGCGGGGGAGCC
28

NC_003106_1
NC_003106_2
CTTTCAATTCCTTTTGGGATTCATC
25

NC_003106_6
NC_003106_8
CTTTCAATTCCATTAAGGATTATC
24

NC_003106_7
CTTTCAATTCCATTATGGATTAGC
24

NC_003116_1
NC_010120_10
NC_013016_9
NC_017512_15
NZ_CP007524_1
NZ_CP009418_6
NZ_CP012694_7
NZ_CP016646_10
NZ_CP016646_5
NZ_CP016646_9
NZ_CP016654_16
NZ_CP016654_3
NZ_CP016654_4
NZ_CP016660_8
NZ_CP016660_9
NZ_CP016671_12
NZ_CP016671_15
NZ_CP016671_16
NZ_CP016672_16
NZ_CP016672_17
NZ_CP016680_5
NZ_CP016680_6
NZ_CP016682_3
NZ_CP016682_4
GGATTCCCGCCTGCGCGGGAATGACG
26

NC_003116_10
NC_010120_5
NC_014752_11
NC_017501_11
NC_017512_9
NC_017517_9
NC_020515_1
NZ_CP006942_1
NZ_CP006954_4
NZ_CP006955_4
NZ_CP007524_12
NZ_CP012694_18
NZ_CP016646_11
NZ_CP016647_14
NZ_CP016654_5
NZ_CP016660_7
NZ_CP016671_1
NZ_CP016671_17
NZ_CP016672_15
NZ_CP016680_4
NZ_CP016682_2
GTTGTAGCTCCCTTTCTCATTTCGCAGTGCTACAAT
36

NC_003143_2
NC_003143_3
NC_003143_4
NC_004088_2
NC_004088_3
NC_004088_4
NC_005810_1
NC_005810_3
NC_006155_4
NC_006155_6
NC_006155_7
NC_006369_2
NC_006369_3
NC_006371_1
NC_006526_1
NC_006526_2
NC_006526_3
NC_008149_1
NC_008149_2
NC_008149_3
NC_008150_3
NC_008150_4
NC_008150_5
NC_008750_6
NC_009381_1
NC_009381_3
NC_009381_4
NC_009708_3
NC_009708_4
NC_010159_2
NC_010465_2
NC_010465_3
NC_010634_5
NC_010634_6
NC_010694_3
NC_012214_4
NC_012214_5
NC_012962_8
NC_013355_1
NC_013355_2
NC_013355_3
NC_014029_2
NC_014029_3
NC_014029_4
NC_017154_2
NC_017154_3
NC_017154_4
NC_017160_2
NC_017160_3
NC_017160_4
NC_017168_3
NC_017168_4
NC_017168_5
NC_017262_1
NC_017262_4
NC_017265_3
NC_017265_5
NC_017390_4
NC_017390_5
NC_017445_3
NC_017566_1
NC_017856_2
NC_018145_2
NC_018145_3
NC_022900_1
NC_022900_2
NC_022900_3
NZ_CM001972_8
NZ_CM001972_9
NZ_CM001977_7
NZ_CM001977_8
NZ_CM001983_5
NZ_CM001983_6
NZ_CM001983_7
NZ_CP003709_1
NZ_CP003709_2
NZ_CP003709_3
NZ_CP003715_1
NZ_CP003715_2
NZ_CP003715_3
NZ_CP006748_1
NZ_CP006748_2
NZ_CP006748_5
NZ_CP006751_1
NZ_CP006751_4
NZ_CP006751_5
NZ_CP006754_1
NZ_CP006754_4
NZ_CP006754_5
NZ_CP006758_2
NZ_CP006758_3
NZ_CP006758_4
NZ_CP006762_1
NZ_CP006762_2
NZ_CP006762_5
NZ_CP006783_1
NZ_CP006783_2
NZ_CP006783_3
NZ_CP006792_2
NZ_CP006792_6
NZ_CP006794_1
NZ_CP006794_4
NZ_CP006806_2
NZ_CP006806_3
NZ_CP006806_5
NZ_CP007044_3
NZ_CP007142_4
NZ_CP007142_6
NZ_CP007142_7
NZ_CP007230_2
NZ_CP007230_3
NZ_CP007555_2
NZ_CP008943_1
NZ_CP008943_8
NZ_CP009364_1
NZ_CP009364_2
NZ_CP009492_1
NZ_CP009492_2
NZ_CP009492_6
NZ_CP009704_2
NZ_CP009704_4
NZ_CP009712_2
NZ_CP009712_9
NZ_CP009715_3
NZ_CP009715_4
NZ_CP009715_5
NZ_CP009723_1
NZ_CP009723_2
NZ_CP009723_3
NZ_CP009757_3
NZ_CP009757_4
NZ_CP009759_1
NZ_CP009759_7
NZ_CP009780_3
NZ_CP009780_4
NZ_CP009785_3
NZ_CP009785_4
NZ_CP009785_5
NZ_CP009786_3
NZ_CP009786_4
NZ_CP009792_2
NZ_CP009792_3
NZ_CP009836_1
NZ_CP009836_4
NZ_CP009840_1
NZ_CP009840_2
NZ_CP009840_5
NZ_CP009844_3
NZ_CP009844_4
NZ_CP009844_5
NZ_CP009906_1
NZ_CP009906_2
NZ_CP009906_6
NZ_CP009973_1
NZ_CP009973_2
NZ_CP009973_3
NZ_CP009991_3
NZ_CP009991_5
NZ_CP009996_2
NZ_CP009996_3
NZ_CP009996_4
NZ_CP009997_1
NZ_CP009997_2
NZ_CP010023_1
NZ_CP010067_2
NZ_CP010067_3
NZ_CP010247_3
NZ_CP010247_4
NZ_CP010247_5
NZ_CP010293_3
NZ_CP010293_4
NZ_CP011104_2
NZ_CP014544_2
NZ_CP016273_3
NZ_CP016273_4
NZ_CP016868_2
NZ_CP016868_3
NZ_CP016870_2
NZ_CP016870_3
NZ_CP016872_1
NZ_CP016873_2
NZ_CP016874_1
NZ_CP016874_2
NZ_CP016876_2
NZ_LN554846_1
NZ_LN554847_1
GTTCACTGCCGCACAGGCAGCTTAGAAA
28

NC_003155_11
CGACCCACCTCCGCTCGCGCGGAGAGAAC
29

NC_003155_12
NC_003155_13
GTGCTCTCCGCGCGAGCGGAGGTGAACCG
29

NC_003210_2
NC_017544_2
NC_017546_2
NC_018588_2
NC_018589_2
NC_021823_3
NC_022568_2
NZ_CP007684_2
NZ_CP007685_2
NZ_CP007687_2
NZ_CP007688_2
NZ_CP011397_1
NZ_CP013723_1
NZ_CP014261_2
NZ_CP014790_2
NZ_HG813249_2
GTTTTAGTTACTTATTGTGAAATGTAAAT
29

NC_003212_2
GTTTTGTTAGCATTCAAAATAACATAGCTCTAAAAC
36

NC_003228_3
NC_006347_2
NZ_CP012706_3
ATTTCAATTCCATAAGGTACAATTAATAC
29

NC_003228_4
NC_016776_2
NZ_CP012706_5
NZ_LN877293_2
GTTGTGATTTGCTTTCAAATTAGTATCTTTGAACCATTGGAAACAGC
47

NC_003272_10
NC_003272_11
GTTTCCATCCCCGTGAGGGGTAAGAGATTAAAAAC
35

NC_003272_13
NC_003272_14
GTTTCAATCCCTGATAGGGATTTTTGTTAGTTAAAAC
37

NC_003272_16
GTTGCAACACCATATAATCCCTATTAGGGATTGAAAC
37

NC_003272_17
CTTTCAACCCTCCCATTACTGGAAGGAGGGTTGCAACG
38

NC_003272_19
GTTTCCATCCCCTTTCGGGGTGATGTGATCGGAAAG
36

NC_003272_2
GTTACTTACCATCACTTCCCCGCAAGGGGATGGAAAC
37

NC_003272_20
NC_007413_9
GTTAAAACCCTCTAAAATCCCTATCAGGGATTGAAAC
37

NC_003272_3
NC_007413_19
ATTGCAATTAACTAAAATCCCTATCAGGGATTGAAAC
37

NC_003272_6
NC_003272_7
NC_007413_13
NC_019682_11
NC_019682_12
NC_019682_7
GTTTCCATCCCCGTGAGGGGTAAAGGAATTAAAAC
35

NC_003272_8
GTTTCTATTAACACAAATCCCTATCAGGGATTGAAAC
37

NC_003364_1
NC_003364_2
NC_003364_6
NC_003364_7
NC_016645_1
NC_016645_2
NC_016645_3
NC_016885_2
GTTTCAACTATCTTTTGATTTCTGG
25

NC_003364_3
NC_009376_2
NC_009376_3
NC_009376_6
NC_016070_6
NC_016885_4
NC_016885_5
GAATCTCAAAAAGAGGATTGAAAG
24

NC_003364_5
GTTTCAATTCTTTTGTAGATTCTTC
25

NC_003413_2
NC_003413_4
NC_003413_7
NC_018092_1
NC_018092_3
NC_018092_6
GTTCCAATAAGACTACAAAAGAATTGAAAG
30

NC_003413_3
NC_018092_2
GTTTCAGTAGAACGTAATCGTGTGGAAAG
29

NC_003413_5
NC_018092_4
CTTTCAATTCTATTTTGGTCTTATTGTAAC
30

NC_003413_6
NC_018092_5
GTTACAATAAGACTAAAATAGAATTGAAAG
30

NC_003413_8
CTTCAATTCTTTTGTAGTCTTATTGGAAC
29

NC_003454_2
NZ_CM000440_2
NZ_CP012716_3
NZ_CP013121_1
NZ_CP013331_7
NZ_CP013334_2
NZ_LN831027_2
ATTTAAATTCTAATATAGAAATACATAAAT
30

NC_003551_1
GTTTCATTACCCGTATTATTACGGGTTAATTGCGAG
36

NC_003551_2
GTTTCATTACCCGTGTTATTACGGGTTAATTGCGAG
36

NC_003551_3
CTCGCAATTAACCCGTAATAATATGGGTAATGAAA
35

NC_003551_4
GTTTCATTACCCGTATTATTGCGGGTTAATTGCGAG
36

NC_003551_5
GTTTCATTACCCATATTATTGCGGGTTAATTGCGAG
36

NC_003552_14
NZ_CP009501_11
NZ_CP009516_1
GTTTCAATCCTTGTTTTAATGGATCTTGCTCTCGAAT
37

NC_003552_15
NC_007955_3
NZ_CP009503_16
NZ_CP009504_15
GTTTCAATCCCTCTAAGGTCTGATTTTAAC
30

NZ_CP009516_8
ATAATATTGCAAATTCAAACAGG
23

NC_003552_4
NZ_CP009514_11
NZ_CP009516_7
NZ_CP009520_7
NZ_CP009524_7
ATTCGAGAGCAAGATCCACTAAAACAAGGATTGAAAC
37

NC_003552_5
NC_003552_6
NZ_CP009509_2
NZ_CP009511_4
NZ_CP009515_11
NZ_CP009515_13
NZ_CP009515_14
NZ_CP009515_15
NZ_CP009515_18
NZ_CP009515_19
NZ_CP009515_20
ATTCGCGAGCAAGATCCACTAAAACAAGGATTGAAAC
37

NC_003869_2
GTTTTTAGCCTACCTAAAAGGGATTGAAAC
30

NC_003869_3
NC_003869_4
NZ_CP009170_5
GTTTCAATCCCTCTTAGGTAGGCTAAAAAC
30

NC_003901_10
NC_007355_11
NZ_CP008746_16
NZ_CP008746_20
NZ_CP009503_14
NZ_CP009504_17
NZ_CP009504_18
NZ_CP009505_29
NZ_CP009506_5
NZ_CP009508_7
NZ_CP009509_6
NZ_CP009512_10
NZ_CP009513_4
NZ_CP009513_5
NZ_CP009517_7
NZ_CP009520_2
NZ_CP009524_2
NZ_CP009526_34
NZ_CP009528_28
NZ_CP009528_5
NZ_CP009530_14
NZ_CP009530_22
GTTTCAATCCTTGTTTTAGTGGATCTTGCTCACGAAT
37

NC_003901_2
NC_003901_3
NC_020389_5
NC_020389_6
GTTTCAATCCTTGTTTTAATGGAT
24

NC_003901_4
NZ_CP009511_1
NZ_CP009513_3
NZ_CP009514_2
GTTTCAATCCTTGTTTTAATGGATCTTGCTCGCGAAT
37

NC_003903_1
NC_022785_21
NC_022785_22
NC_022785_23
NC_022785_24
NC_022785_25
NC_022785_26
NZ_CP009439_4
NZ_CP012382_10
NZ_CP012382_9
NZ_CP013142_1
NZ_CP013142_2
NZ_CP013142_27
NZ_CP013142_4
CTGCTCCCCGCACCCGCGGGGATGGTCCC
29

NC_003919_5
NC_013722_4
NZ_CM002139_4
NZ_CP006857_5
NZ_CP008989_5
NZ_CP008992_5
NZ_CP008995_5
NZ_CP008998_5
NZ_CP009001_5
NZ_CP009004_5
NZ_CP009007_5
NZ_CP009010_5
NZ_CP009013_5
NZ_CP009016_5
NZ_CP009019_5
NZ_CP009022_5
NZ_CP009025_5
NZ_CP009028_5
NZ_CP009031_6
NZ_CP009034_6
NZ_CP009037_6
NZ_CP009040_6
NZ_CP011827_5
NZ_CP011971_1
GTCGCGCCCTCACGGGCGCGTGGATTGAAAC
31

NC_003923_9
CTTCTATGTTGGGGCCCCGCCAACTTG
27

NZ_CM002395_4
NZ_CM002401_5
NZ_CP001970_3
NZ_CP001974_3
NZ_CP006742_3
NZ_CP007666_2
NZ_CP007704_1
NZ_CP008846_3
NZ_CP009315_4
NZ_CP009328_1
NZ_CP009341_1
NZ_CP009697_1
NZ_CP010322_1
NZ_CP010342_6
NZ_CP010792_3
NZ_CP010813_3
NZ_CP010852_4
NZ_CP012519_3
NZ_CP012720_3
NZ_CP012721_3
NZ_CP012722_3
NZ_CP012723_3
NZ_CP012724_3
NZ_CP012725_3
NZ_CP012726_3
NZ_CP012727_3
NZ_CP012728_3
NZ_CP012729_3
NZ_CP012730_3
NZ_CP014179_3
NZ_CP015779_3
TTTCGGAATGAACATTCATTCCT
23

NC_003997_5
NC_004722_2
NC_005945_5
NC_005957_3
NC_007530_5
NC_008600_5
NC_011725_2
NC_011772_4
NC_011773_5
NC_012472_3
NC_012581_6
NC_012659_5
NC_014171_3
NC_014335_2
NC_016779_6
NC_017208_3
NC_017729_4
NC_018508_5
NC_018877_3
NC_020238_2
NC_020376_3
NC_022781_2
NC_022873_3
NZ_CM000716_5
NZ_CM000717_1
NZ_CM000722_4
NZ_CM000726_4
NZ_CM000727_4
NZ_CM000732_5
NZ_CM000734_3
NZ_CM000738_4
NZ_CM000750_4
NZ_CM000752_3
NZ_CM000754_3
NZ_CM001804_6
NZ_CM002395_6
NZ_CM002398_5
NZ_CM002401_7
NZ_CM002879_7
NZ_CP001970_5
NZ_CP001974_5
NZ_CP004858_2
NZ_CP004870_2
NZ_CP006742_5
NZ_CP007666_4
NZ_CP007704_3
NZ_CP008846_5
NZ_CP009315_1
NZ_CP009318_4
NZ_CP009328_3
NZ_CP009335_1
NZ_CP009341_3
NZ_CP009544_5
NZ_CP009600_4
NZ_CP009641_5
NZ_CP009686_3
NZ_CP009697_4
NZ_CP010089_3
NZ_CP010322_3
NZ_CP010342_9
NZ_CP010577_5
NZ_CP010792_5
NZ_CP010813_5
NZ_CP010852_1
NZ_CP011145_2
NZ_CP011151_3
NZ_CP011153_3
NZ_CP011155_2
NZ_CP012519_5
NZ_CP012691_3
NZ_CP012720_5
NZ_CP012721_5
NZ_CP012722_5
NZ_CP012723_5
NZ_CP012724_5
NZ_CP012725_5
NZ_CP012726_5
NZ_CP012727_5
NZ_CP012728_5
NZ_CP012729_5
NZ_CP012730_5
NZ_CP014179_5
NZ_CP014847_4
NZ_CP015150_2
NZ_CP015176_5
NZ_CP015727_3
NZ_CP015779_5
GTTGATTTCTCTTCTTTTTGAGA
23

NC_004116_1
NC_004368_1
NC_007432_1
NC_013798_2
NC_015215_1
NC_015215_2
NC_017576_2
NC_018646_1
NZ_CP006910_3
NZ_CP007573_2
NZ_CP007631_1
NZ_CP007632_2
NZ_CP010319_1
NZ_CP010867_1
NZ_CP010874_2
NZ_CP010875_2
NZ_CP011325_1
NZ_CP011326_1
NZ_CP011327_1
NZ_CP011329_1
NZ_CP012419_2
NZ_CP012503_2
NZ_CP013202_1
NZ_CP016391_2
NZ_LT545678_1
GTTTTAGAGCTGTGCTGTTTCGAATGGTTCCAAAAC
36

NC_004342_10
NC_004342_11
NC_004342_12
NC_004342_15
NC_004342_3
NC_004342_4
NC_004342_9
NC_017551_10
NC_017551_11
NC_017551_12
NC_017551_13
NC_017551_14
NC_017551_8
NC_017551_9
CTGAATATAACTTTGATGCCGTTAGGCG
28

NC_004350_1
NC_008532_5
NC_013928_2
NC_017563_3
NC_017581_3
NC_017768_2
NC_017927_3
NC_018089_1
NC_021900_1
NC_021900_2
NZ_CP006819_7
NZ_CP007016_1
NZ_CP010999_7
NZ_CP011217_4
NZ_CP012588_3
NZ_CP013237_1
NZ_CP016026_3
NZ_CP016394_2
GTTTTGGAACCATTCGAAACAACACAGCTCTAAAAC
36

NC_004369_1
CCCTCAATGAAAGGCCGTCGAACTAACGACGGCAGG
36

NC_004547_5
NC_004547_6
NC_004547_7
NC_004741_2
NC_005126_4
NC_005126_7
NC_006366_1
NC_007384_2
NC_007946_2
NC_007946_3
NC_008253_3
NC_008258_2
NC_008563_2
NC_008563_3
NC_009436_5
NC_009436_6
NC_009778_14
NC_009800_1
NC_010468_5
NC_011742_2
NC_011742_3
NC_011745_2
NC_011745_3
NC_011750_4
NC_011751_3
NC_011993_2
NC_011993_3
NC_012962_10
NC_013971_3
NC_016612_4
NC_016818_1
NC_016818_2
NC_017626_3
NC_017628_2
NC_017628_3
NC_017632_3
NC_017632_4
NC_017634_2
NC_017634_3
NC_017646_1
NC_017933_18
NC_020063_2
NC_020064_2
NC_020064_3
NC_020064_5
NC_022370_2
NC_022370_3
NZ_CP005930_5
NZ_CP005930_6
NZ_CP006636_1
NZ_CP007149_2
NZ_CP007149_3
NZ_CP007265_2
NZ_CP007390_6
NZ_CP007391_6
NZ_CP007592_2
NZ_CP007744_10
NZ_CP007744_7
NZ_CP007744_8
NZ_CP007744_9
NZ_CP008697_1
NZ_CP008788_1
NZ_CP008841_4
NZ_CP009125_6
NZ_CP009125_7
NZ_CP009125_8
NZ_CP009125_9
NZ_CP009706_3
NZ_CP009706_5
NZ_CP009850_1
NZ_CP009850_2
NZ_CP009850_3
NZ_CP009859_1
NZ_CP009866_3
NZ_CP010377_1
NZ_CP010377_2
NZ_CP010423_6
NZ_CP011047_2
NZ_CP011104_1
NZ_CP011254_3
NZ_CP011254_4
NZ_CP011254_5
NZ_CP012268_6
NZ_CP012625_3
NZ_CP012625_4
NZ_CP012631_3
NZ_CP012631_4
NZ_CP012633_3
NZ_CP012633_4
NZ_CP012635_4
NZ_CP013990_9
NZ_CP014007_1
NZ_CP014034_1
NZ_CP014034_2
NZ_CP014667_2
NZ_CP015379_4
NZ_CP015379_5
NZ_CP015750_3
NZ_CP015834_1
NZ_CP015940_1
NZ_CP016007_6
NZ_CP016007_7
NZ_CP016034_1
NZ_CP016034_2
NZ_CP016358_6
NZ_CP017181_1
NZ_CP017184_1
NZ_LN554852_1
TTTCTAAGCTGCCTGTACGGCAGTGAAC
28

NC_004557_1
GTATTAGTAGCACCATATTGGAATGTAAAT
30

NC_004557_2
NC_004557_3
NC_004557_5
NC_004557_7
NC_004557_8
NC_022777_3
NC_022777_5
NC_022777_7
NC_022777_8
ATTTAAATACAACTCTTGTTATTGTTCAAC
30

NC_004557_4
NC_004557_6
NC_022777_2
NC_022777_4
NC_022777_6
NZ_CP009267_1
NZ_CP009267_2
NZ_CP009268_1
NZ_CP009268_2
NZ_CP013018_1
NZ_CP013018_2
NZ_CP013019_1
NZ_CP013019_2
ATTTAAATACATCCTATGTTAAGGTTCAAC
30

NC_004605_2
NC_019971_3
GTGAACTGCCGAATAGGTAGCTGATAAT
28

NC_004757_1
GTCTCAATCCCTTTGAAATCAGGGCATCGGTGTTTC
36

NC_004757_2
GTAGCGCCCGGTCACCAGACCGGGCGAGGATTGAAAC
37

NC_004829_1
NC_017502_1
NC_018406_1
NC_018407_1
NC_018408_1
NC_018409_1
NC_018410_1
NC_018411_1
NC_018412_1
NC_018413_1
TTTTTCTTAACAAAATAATTGTACAA
26

NC_004829_4
NC_017502_4
NC_017503_1
NC_018406_3
NC_018407_3
NC_018408_3
NC_018409_3
NC_018410_2
NC_018411_3
NC_018412_3
NC_018413_3
NC_023030_4
GTTTTAGCACTGTACAATACTTGTGTAAGCAATAAC
36

NC_005085_1
GTCGCGCCCAACGCGGGCGCGTGGATTGAAAC
32

NC_005085_2
GTGTTCCCCACGTACGTGGGGATGAACCG
29

NC_005085_3
NZ_CP013680_1
GTGTTCCCCACGTGCGTGGGGATGAACCG
29

NC_005085_4
NC_012912_1
NC_020055_6
NC_022579_6
NZ_CM001904_1
NZ_CM001972_10
NZ_CM001977_10
NZ_CM001977_9
NZ_CM001981_1
NZ_CM001981_2
NZ_CM001983_8
TTTCTAAGCTGCCTATCCGGCAGTGAAC
28

NC_005090_1
GTTATAGCCGCCTACTCAGCCATTCCTCGCTATAAT
36

NC_005090_2
GCAACACTTTATAGCAAATCCGCTTAGCCTGTGAAAC
37

NC_005126_2
NC_005126_3
NC_005126_5
NC_005126_6
NC_012962_6
NC_021046_1
NZ_CP009450_5
NZ_CP011104_3
NZ_CP015613_1
NZ_CP017180_3
NZ_CP017184_3
NZ_LT160614_1
GTGCACTGCCGTACAGGCAGCTTAGAAA
28

NC_005140_1
NC_005140_2
GTTTCAGACATGCCCGGTTTAGACGGGATTAAGAC
35

NC_005213_1
NC_005213_2
CTTTCAATATTTCTAATATATTAGAAAC
28

NC_005230_1
CTTTCCTTCTACTAATCCCGGCGATCGGGACTGAAAC
37

NC_005230_2
GTTCAACACCCTCTTTTCCCCGTCAGGGGACTGAAAC
37

NC_005230_3
NZ_CP007543_1
GTCTCCACTCGTAGGAGAAATTAATTGATTGGAAAC
36

NC_005823_1
NZ_CP006723_10
NZ_CP006723_11
NZ_CP006723_12
NZ_CP006723_13
NZ_CP006723_14
NZ_CP006723_15
NZ_CP006723_9
NZ_CP012603_10
NZ_CP012603_11
NZ_CP012603_12
NZ_CP012603_13
NZ_CP012603_14
NZ_CP012603_15
NZ_CP012603_16
NZ_CP012603_17
NZ_CP012603_6
NZ_CP012603_7
NZ_CP012603_8
NZ_CP012603_9
NZ_CP013147_5
NZ_CP013147_6
NZ_CP013147_7
NZ_CP013147_8
GTGCTCAACGCCTAACGGCATCAAAGTTATATTCAG
36

NC_005823_3
NZ_CP011410_6
NZ_CP011410_7
TTCCTAAAGAAATAGGGAATTTAAAAAA
28

NC_005835_1
NC_005835_2
NC_005838_2
NC_005838_3
NC_005838_9
NC_006461_1
NC_006461_2
NC_006462_1
NC_006462_3
NC_006462_4
NC_006462_5
NC_006462_6
GTTGCAAGGGATTGAGCCCCGTAAGGGGATTGCGAC
36

NC_005838_4
NC_005838_5
NC_017273_6
NC_017273_7
NZ_CP014142_1
GTTTCAATCCTCACCGGCCCTTTCGGGCCGGTGCAAC
37

NC_005838_6
GTTGCAAGGGATTGAACCCCGTAAGGGGATTGCGAC
36

NC_005838_7
NC_005838_8
NC_017273_3
NC_017273_4
NC_017588_3
NC_017588_4
NC_017588_5
GTTTCAATCCTCTACGAGGCTAACGAGGTTTGCAAC
36

NC_005863_3
NC_014972_1
NC_016803_4
NC_017311_1
GTCGCCCCCCACGCGGGGGCGTGGATTGAAAC
32

NC_005871_1
CGGTTCAGCCCCGTGAGTACGGGGAACAC
29

NC_005877_1
NC_005877_5
CTTTCAATCCTATTTAGGTTATTATTTAAC
30

NC_005877_2
NC_005877_3
CTTCCATACTATCTAGTAATTCTTAAAC
28

NC_005966_1
TTTCTAAGCTGCCTGTGCGGCAGTTAAG
28

NC_005966_2
CTTCACTACCGCACAGGTAGCTTAGAAA
28

NC_005966_3
GTTCGTCATCGCATAGATGATTTAGAAA
28

NC_006138_2
GCTTCAATGTAGTCACCCCTTTCGAGGTGATTGATAC
37

NC_006177_1
GTAGCACCCGGCCGCGAGGCCGGGTGAGGATTGAAAC
37

NC_006177_2
NC_006177_3
GTCGTCCCCACGCGCGTGGGGGTGAACCG
29

NC_006300_1
NC_006300_2
GTTTCAATTCACGCTCTCGTGTGAGAGCGGAG
32

NC_006300_5
GTTTCAATCCCTTTAAGACAGGGCAAGGTCTTTCGAC
37

NC_006361_12
NZ_LN868939_12
NZ_LN868939_13
NZ_LN868939_16
NZ_LN868939_6
NZ_LN868939_7
GGGCTCATCCCCGCGTGCGCGGGGAGCAC
29

NC_006361_13
NZ_LN868939_14
GGGCTCATCCCCGCACGCGCGGGGAGCAC
29

NC_006361_15
GTGCTCCCCGCGCACGCGGGGATGAGCC
28

NC_006368_1
NZ_CP011105_1
NZ_CP015927_1
NZ_CP015929_1
NZ_CP015931_1
NZ_CP016030_1
CCAATAATCCCTCATCTAAAAATCCAACCACTGAAAC
37

NC_006391_2
GCTTCAACCCCACAAGGGTCCGTCTGAAAC
30

NC_006392_1
NC_006392_3
GTTACAGACGGACCCTCGTGGGGTTGAAGC
30

NC_006392_2
GTTTCAGACGGACCCTTGGGCGGTTGAAGT
30

NC_006448_1
NC_006449_1
NC_008532_2
NC_009785_2
NC_017563_1
NC_017581_1
NC_017595_3
NC_017927_1
NC_022584_3
NZ_CP006819_4
NZ_CP010999_4
NZ_CP011217_1
NZ_CP012588_1
NZ_CP013939_2
NZ_CP016026_8
NZ_CP016394_1
NZ_CP016439_1
NZ_CP016877_2
NZ_CP017295_2
GTTTTTGTACTCTCAAGATTTAAGTAACTGTACAAC
36

NC_006448_2
NC_008532_4
NC_017581_2
NZ_CP006819_5
NZ_CP010999_5
NZ_CP011217_3
NZ_CP016026_1
NZ_CP016877_3
GATATAAACCTAATTACCTCGAGAGGGGACGGAAAC
36

NC_006462_10
GTTGCAAACCTCGTTAGCCTCGTAGAGGATTGA
33

NC_006462_7
NC_015387_5
CGGTCCATCCCCACGTGCGTGGGGACTAC
29

NC_006462_8
NC_017588_2
GTAGTCCCCACGCGTGTGGGGATGGACCG
29

NC_006462_9
GTTTCAATCCTCTACGAGGCTGACGGGGTTTGCAACG
37

NC_006510_1
NC_006510_2
NC_006510_6
NC_013411_2
NC_013411_3
NC_013411_4
NC_013411_5
NC_013411_6
NC_013411_9
NC_014915_1
NC_014915_2
NC_014915_3
NC_014915_6
NC_014915_7
NC_014915_8
NC_016593_1
NC_016593_3
NC_020210_1
NC_020210_2
NC_020210_3
NC_020210_4
NC_020210_5
NZ_CP008903_1
NZ_CP008903_4
NZ_CP008903_6
NZ_CP008903_7
NZ_CP008934_3
NZ_CP008934_4
NZ_CP008934_5
NZ_CP008934_6
NZ_CP011832_1
NZ_CP011832_3
NZ_CP011832_4
NZ_CP014335_2
NZ_CP014335_4
NZ_CP014342_3
NZ_CP014342_4
NZ_CP014342_7
NZ_CP014342_8
NZ_CP014342_9
NZ_CP014749_2
NZ_CP014749_3
NZ_CP014749_7
NZ_CP014749_8
NZ_CP014749_9
NZ_CP017071_4
NZ_CP017071_7
NZ_CP017071_8
GTTTTTATCGTACCTATGAGGGATTGAAAC
30

NC_006510_3
GTTTCAATCCCTCATAGGTACGATAAAAACT
31

NC_006513_1
NC_006513_2
NC_006513_3
GTTTCAATCCACGCCCCCCGTCACCGAGGGGCGATGC
37

NC_006582_10
ATTTCAATCCACGTACCCACAAAGAGTGCGAC
32

NC_006582_11
NZ_CP012475_7
NZ_CP012475_9
ATTTCAATCCACGCACTCACTAAGAGTGCGAC
32

NC_006582_3
NC_006582_4
NZ_CP012475_12
NZ_CP012475_13
NZ_CP012475_3
NZ_CP012475_5
ATTTCAATCCACGCACTCACAAAGAGTGCGAC
32

NC_006582_5
NZ_CP012475_2
ATTTCAATCCACGCACTCACATAGAGTGCGAC
32

NC_006582_6
NC_006582_7
NC_016641_12
NC_016641_2
NC_016641_3
NC_016641_4
NC_016641_5
NC_016641_9
NC_023037_1
NC_023037_3
NC_023037_4
NZ_CP006872_1
NZ_CP009909_1
NZ_CP015423_1
NZ_CP017770_6
ATTTCAATCCACGCACTCATATAGAGTGCGAC
32

NC_006582_8
ATTTCAATCCACGCACTCACAAAGAGTGCGAT
32

NC_006624_1
ATTTCAATTCTCCTAGAGTCTTATTGCAAC
30

NC_006624_2
NC_011529_5
NC_011529_6
GTTTCAATTCTCTTAGAGTCTTATTGCAAC
30

NC_006624_3
GTTGCAATAAGACTCTAAGAGAATTGAAAG
30

NC_006814_1
NC_021181_1
NZ_CP010432_1
GGATCACCTCCACATACGTGGAGAAAAT
28

NC_006823_1
NC_006823_2
GTGTTCCCCGCGCATCGCGGGGGTTGAAG
29

NC_006834_1
NC_007705_1
NC_010717_1
NZ_CM003052_6
NZ_CP007166_1
NZ_CP007810_2
NZ_CP012947_1
NZ_CP013670_1
NZ_CP013674_1
NZ_CP013675_1
NZ_CP013676_1
NZ_CP013677_1
NZ_CP013678_1
NZ_CP013679_1
NZ_CP013961_1
NZ_LT604072_1
GTTTCAATCCACGCGCCCGTGAGGACGCGAC
31

NC_006908_1
GTTTAAGAATACATAAGAATGATACTACACCAAAAC
36

NC_007164_2
NC_010545_6
NC_020230_4
GGCTCATCCCCGCTGGCGCGGGGAGCAC
28

NC_007181_1
NC_007181_2
NC_020246_1
NC_020246_2
NC_020247_1
NC_020247_2
NZ_CP013695_1
NZ_CP013695_2
GTTTTAGTTTCTTGTCGTTATTAC
24

NC_007181_3
NC_020246_3
NC_020247_3
NZ_CP013695_4
CTTTCAATCCCTTATGGGATTCTTC
25

NC_007181_4
NC_020246_4
NC_020247_4
NZ_CP013695_3
CTTTCAATCCCTTTTGGGATTCATC
25

NC_007294_1
GTTTTGGGGTTGTACAATTATTTTGTTAAGTAAAAC
36

NC_007333_1
GGATCATCCCCGCGTGCGCGGGGAGCACA
29

NC_007333_10
GGACCATCCCCGCATGCGCGGGAAGCAC
28

NC_007333_11
GGGACCATCCCCGCATGCGCGGGGAGCAC
29

NC_007333_12
NC_007333_13
NC_007333_15
NC_007333_16
NC_007333_7
NC_007333_8
NC_018524_1
NC_018524_2
NC_018524_27
NC_018524_28
NC_018524_31
NC_018524_32
CGGTCCATCCCCACGTGCGTGGGGCTCAC
29

NC_007333_3
GTGCTCCCCACGCACGTGGGGATGGTCCG
29

NC_007333_4
NC_007333_5
GGTCCATCCCCACGTGCGTGGGGAGCAT
28

NC_007333_6
GTGCTCCCCGCGCATGCGGGGATGGTCC
28

NC_007333_9
GAGAGCCCCACGCACGTGGGGATGGACCG
29

NC_007355_3
NZ_CP009526_5
GTTAAAATCAGGCCTTAGAGGGATTGAAAC
30

NC_007355_32
NZ_CP009526_18
GCTTCAATTCTGCCACAACCTTTCGGTTATGGAAAC
36

NC_007355_4
GTCGAGAGGTAGCTTCCACTAAAATAAGGATTGAAA
36

NC_007356_1
NC_013890_1
NC_020386_2
NZ_CP011127_1
CGGTTCACCCCCACATGCGTGGGGAATAC
29

NC_007384_5
NZ_CP007534_2
NZ_CP010829_5
NZ_CP011416_1
NZ_CP014099_7
CGGTTTATCCCCGCTGGCGCGGGGAAC
27

NC_007406_3
GTTTCGACCCACGCCCCCGCGAAGGGGGCGAC
32

NC_007413_11
GTGACAATAGCCCTTCCCGTGTTGAGCGGGTTGAAAG
37

NC_007413_15
GTGCTTTAACATTAGATGTCGTTAGGCGTTGAGCA
35

NC_007413_16
GTTGCAACACCACATAATCCCTATTAGGGATTGAAAC
37

NC_007413_17
GTTTCAATCCCTGATAGGGATTTTTGTT
28

NC_007413_18
GTTTCTATTAACACAAATCCCTATCAGGGATTGAAAG
37

NC_007413_3
GTTTTAATTAACAAAAATCCCTATCAGGGATTGAAAC
37

NC_007413_4
GTTTCAACACCCCTCCCGAAGTGGGGCGGGTTGAAAG
37

NC_007413_5
CTTTCAACCCGCCCCTAGCCGGGATGGTCGTTGAAAC
37

NC_007426_1
NC_007427_1
NC_013967_2
GTTTCAGACGAACCCTTGTGGGGTTGAAGC
30

NC_007426_5
NC_007428_1
GTCGAGACGGACTGAAAACCCAGAACGGGATTGAAAC
37

NC_007484_1
GTTCACCGCCGCACAGGCGGTTTAGAAA
28

NC_007498_1
GAGTTCCCCGCAGATGCGGGGATGAACCG
29

NC_007503_3
GTTTCAATCCCAGAATGGTTCGATTAAAAC
30

NC_007503_4
GTTTCAATCCCAGATTGGTTCGATTAAAAC
30

NC_007512_1
NC_009434_3
NC_015572_3
NC_015572_4
NC_015572_5
NZ_AOOB01000047_1
NZ_AOOM01000229_1
NZ_CM001838_4
NZ_CM001838_5
NZ_CM001840_1
NZ_CM001841_1
NZ_CM001841_2
NZ_CM001974_4
NZ_CM002023_1
NZ_CM002023_2
GTCGCGCCCCACGCGGGCGCGTGGATTGAAAC
32

NC_007514_1
GTTTCAATCCACGCGCCCGCGAAGGGCGCGAC
32

NC_007514_2
ATTTCAATTCCATATTGGTGCAATTAGAAG
30

NC_007517_2
GTAGCGCCCGCCTACATAGGCGGGCGAGGATTGAAAC
37

NC_007519_1
CGGTTCATCCCCGCGGGTGCGGGGAACAC
29

NC_007643_1
NC_007643_2
NC_017584_1
NC_017584_2
GCGGTTCATCCCCGCGCATGCGGGGAACAG
30

NC_007643_10
NC_017584_10
GTTTCAATCCACGCCCCCGTGAGGGAGCGAC
31

NC_007643_12
NC_017584_12
CTCGCAGCCTATGCCCCGCCACCGAGGGGACTGAAAC
37

NC_007643_13
NC_007643_3
NC_017584_13
NC_017584_3
GTCTCCCGAGGCAGTAATGCCTCGGCCTCATTGAAAC
37

NC_007643_15
NC_017584_15
CTCGCAGCCCTTGCCCCGCTATCGAGGGGACTGAAAC
37

NC_007643_5
NC_017584_5
GGTTCCCCCGCACTCGTGGGGATAGACCC
29

NC_007643_6
NC_017584_6
ACTCTACCATGGCGGTGTGGGACGGGGCCATGGAAC
36

NC_007643_7
NC_017584_7
NZ_CP014327_1
GTCGCCCCCTTCACGGGGGCGTGGATCGAAAC
32

NC_007643_8
NC_017584_8
GTTTCAGTCCCCTCGATGGCGGGGCATAGGGTGCGAG
37

NC_007643_9
NC_017584_9
NZ_CP015418_1
NZ_CP015421_1
NZ_DF260912_1
CGGTTCATCCCCGCGTGTGCGGGGAACAG
29

NC_007644_1
NZ_CP012369_1
NZ_CP012370_1
GTTTCAACCCTCGCCCGGCATGGAAGCCGGGCGCGAC
37

NC_007644_3
NZ_CP012369_3
NZ_CP012370_3
NZ_CP017019_5
NZ_CP017019_6
GTTCAAATTCCTCTATGGTCGATGGTCAC
29

NC_007645_2
GTCGCCTCCCACGCGGAGGCGTGGATTGAAAC
32

NC_007645_3
GTCGCCTCCCATGCGGAGGCGTGGATTGAAAC
32

NC_007681_1
GTTTAAAATAGACTTAATAGTATGAAAAC
29

NC_007681_2
NC_007681_3
AATAGAATAAGATCATAATGAAATTGAAAT
30

NC_007759_2
GACAGAATTGACCTGATTTACGAAGGGATTGCGAC
35

NC_007759_3
NZ_CP015080_1
NZ_CP015080_2
GTTTCAATCCACGCCCCCGCATGGGGGGCGAC
32

NC_007775_1
CGGTTCACCCCCACGGGTGTGGGGACAAC
29

NC_007775_10
NC_007775_4
NC_007775_6
NC_007775_7
NC_007775_9
NC_007776_1
NC_007776_3
NC_007776_5
NC_007776_9
GTTTCCAATTTCTAGGGATCCCCCCGAAGGGGGAAC
36

NC_007775_2
NC_007775_3
NC_007776_4
NC_007776_8
GTTTCCGTCCCCTTGCGGGGAAAAGGTAGGGATCAAC
37

NC_007775_5
AGTTCCCCCTTCGTGGGGATCCCTAGAAATTGGAAAC
37

NC_007777_1
NZ_CM001489_4
NZ_CM001489_5
GTCGTCCCCGCACGCGCGGGGATCTTCC
28

NC_007777_5
GTTGTGATCCTCGCCGAGGGCGATCCCTCGGCGCTGC
37

NC_007777_6
GCAGCGCCGGGCGTCCGCGCCCGGCGAGGTTCCCAAC
37

NC_007777_7
GGCAGCGCCGGGCGTCCGCGCCCGGCGAGGTTCCCAAC
38

NC_007796_1
NC_007796_2
NC_007796_3
GTTGCCATACCCTTCTATTTTCGGGTCACTTGCAAC
36

NC_007796_4
NC_007796_5
GTTCATCCCCATACACACGGGGAACTC
27

NC_007796_6
NC_007796_7
GTTTCAATCCCTATCGGGTTTTCTTTTCCATTGTGAC
37

NC_007901_1
CCTTCAATCCCCGCGCAACGCGGGGCGCAC
30

NC_007907_1
GTCACTCCTCGTATGAGGAGTGTGGATTGAA
31

NC_007907_2
NC_007907_3
NC_007907_4
NC_007907_5
NC_011830_5
GTTTCAATCCCTCATAGGTAAGCTAACAAC
30

NC_007907_6
GTTTCAATTCCTTATAGGTAAGCTAACAAC
30

NC_007908_6
GGATCGCCCGGCATTCATGTCGGGCGCGGATTGAAAC
37

NC_007925_4
NC_007958_1
GCCGTGGCTTCCCTACCGATTTCCCCGTGGTAGGCT
36

NC_007929_1
NC_017481_1
GTTTCAGAAGTATGTTAAATCAATAAGGTTAAGACC
36

NC_007947_1
GTGTTCCCCGCACATGCGGGGATGAACCG
29

NC_007947_2
GTCGCACCCTGCGCGGGTGCGTGAATTGAAAC
32

NC_007955_2
GAGTTCCCCATGCATGTGGGGATAAACCG
29

NC_007963_1
NC_007963_2
CCGTTCCCCGCAGGCGCGGGGATCAACCG
29

NC_008010_1
CGGACCATCCCCACGCCCGTGGGGAACAC
29

NC_008025_2
NC_008025_3
NC_008025_4
NC_008025_5
NC_008025_6
GTTTCAATCCTCAGCCGCCCCGAAAGACGGCTGCAAC
37

NC_008054_2
NC_008529_2
NC_014727_1
GTATTCCCCACGCAAGTGGGGGTGATCC
28

NC_008095_10
GTTTCAACCCACGCTCCCCGCGTTCACGAGGAGCGAC
37

NC_008095_11
NC_008095_12
GTGCTCAACGCCTTTCGGCATCACGGCGAGCGGGAC
36

NC_008095_13
GTGCTCAACGCCTTCCGGCATCACGGCGAGCGGCAC
36

NC_008148_2
NC_008148_5
GTTTCAATCCCTTATAGGTAGGCTCAAAAC
30

NC_008148_3
TACCAGGCGTGGATCTTGCCCTCGGACAC
29

NC_008148_4
AATCCCTTATAGGTGGGCTCAAAAC
25

NC_008212_1
NC_008212_2
GTTTCAGATGAACCCTTGATGGGTT
25

NC_008261_2
NZ_CP009557_4
TTTTAAACAATATTTGCTTTTAGGT
25

NC_008261_3
GTTAAAAAGATATTATGATAAATTT
25

NC_008262_1
NC_008262_3
NC_020291_13
NC_020291_14
NZ_CM001240_4
GTTTTATATTAACTATGAGGAATGTAAAT
29

NC_008278_10
GTTGCGATCCCTCCAGGGATGATCAGCGACC
31

NC_008278_11
NC_008278_6
NC_009921_3
NC_009921_4
NC_009921_5
NC_009921_6
NC_009921_7
NZ_CM001489_11
NZ_CM001489_12
NZ_CM001489_13
GTCGCTGATCATCCCTGGAGGGATCGCAAC
30

NC_008278_13
GTTGCTATCCCTCTAGGGATGATCAGCGAC
30

NC_008278_2
GTCGTCCCCGCCCGCGCGGGGATCTTCC
28

NC_008278_3
GTCGTCCCCGCCCGCGCGGGGATCGTCC
28

NC_008278_7
GGTTCGTGATCATCCCTGGAGGGATCGCAAC
31

NC_008312_20
CCCCAGCTTTGCCTGAAGCGGAATTAATGGAAAC
34

NC_008340_5
GGTCTATCCCCGCAGGCGCGGGGGAGCC
28

NC_008343_1
NC_017059_5
NZ_CP003182_4
NZ_CP003183_4
CGGTTCATCCCCGCGCAGGCGGGGAACAC
29

NC_008343_2
NZ_CP003182_3
GGACTATCCCCGCGCACGCGGGGGAACC
28

NC_008343_3
NC_008343_4
NZ_CP003182_2
NZ_CP003183_1
GGTCTATCTCCGCGCACGCGGAGGAACC
28

NC_008344_1
GTTTCAATCCTCGCCCAGTCGGGTGACCGGGCGCTACA
38

NC_008344_2
NC_008344_3
GTCTCAATCCCTTTGAAATCAGGGCATGGGTGTTTC
36

NC_008346_10
ATTTCAATACATCAAATGTGCCGGTTCCGC
30

NC_008346_11
GTTTCAATCCCCTATACGCGGGTCACAAAC
30

NC_008346_2
NC_014152_1
NC_014152_2
GTCGCACCCCATGCGGGTGCGTGGATTGAAAC
32

NC_008346_8
NC_008346_9
GTTTCCGTCCCCTTAAAGGGGTCCTTCGTTTTTAAT
36

NC_008385_1
AGCATCGCCACTTCCGGCGAGGC
23

NC_008463_2
NC_009656_2
NC_009656_3
NC_017548_2
NC_017548_4
NC_018080_2
NC_018080_4
NC_023149_2
NC_023149_4
NC_023149_5
NZ_AAQW01000001_2
NZ_AAQW01000001_4
NZ_AP014651_2
NZ_AP014839_3
NZ_CP008860_2
NZ_CP008860_4
NZ_CP008862_1
NZ_CP008863_2
NZ_CP008864_1
NZ_CP008868_8
NZ_CP008869_2
NZ_CP008870_1
NZ_CP008870_4
NZ_CP008872_3
NZ_CP012001_2
NZ_CP012001_5
NZ_CP012066_3
NZ_CP012578_1
NZ_CP012579_1
NZ_CP012580_1
NZ_CP012581_1
NZ_CP012582_1
NZ_CP012583_1
NZ_CP012584_1
NZ_CP012585_1
NZ_CP013245_6
NZ_CP015877_5
NZ_CP015877_7
NZ_CP016214_2
NZ_CP016214_4
NZ_CP016214_5
NZ_HG974234_3
NZ_LN831024_2
NZ_LN831024_5
NZ_LT608330_2
GTTCACTGCCGTATAGGCAGCTAAGAAA
28

NC_008463_3
NC_017548_5
NC_018080_5
NC_023149_6
NC_023149_7
NZ_AAQW01000001_1
NZ_AP014651_4
NZ_CP007147_3
NZ_CP007147_4
NZ_CP008860_5
NZ_CP008861_1
NZ_CP008862_2
NZ_CP008863_1
NZ_CP008868_9
NZ_CP008869_1
NZ_CP008870_3
NZ_CP008872_4
NZ_CP012001_6
NZ_CP012578_2
NZ_CP012579_2
NZ_CP012580_2
NZ_CP012581_2
NZ_CP012582_2
NZ_CP012583_2
NZ_CP012584_2
NZ_CP012585_2
NZ_CP013245_5
NZ_CP015877_4
NZ_CP016214_6
NZ_HG974234_2
NZ_LN831024_6
NZ_LT608330_3
TTTCTTAGCTGCCTACACGGCAGTGAAC
28

NC_008497_1
AGGATCACCCCCACATGTGTGGGGAATAC
29

NC_008497_2
NZ_CP015398_2
GGATCACCCCCACACCTGTGGGGAATAC
28

NC_008526_2
GTTTTCCCCGCACATGCGGGGGTGATCC
28

NC_008553_15
GTCGAAGAGCGAGTTCCAGGAAAACAAGGATTGAAAC
37

NC_008553_32
GTCGCAACGAGTGAGAAAACCCGATAGGGATTGAAAC
37

NC_008554_11
GACGGAGACAGAGCCCCGATTTGAGGGGATTGAGAC
36

NC_008554_19
GTGTTCCCCACGCGGGTGGGGATGAACCG
29

NC_008576_4
GTCGCCCCCTCCCACGGGGGCGTGGATTGAAAC
33

NC_008577_2
ATTTTCAGCTGCCTATTCGGCAGGTCAC
28

NC_008578_17
GCTGGGGAGCCTGTCTCAATCCCCCGGCTAAAATGG
36

NC_008593_2
NC_008593_3
NC_009495_10
NC_009495_4
NC_009495_5
NC_009495_6
NC_009495_7
NC_009495_8
NC_009495_9
NC_009697_10
NC_009697_4
NC_009697_5
NC_009697_6
NC_009697_7
NC_009697_8
NC_009697_9
NC_009698_10
NC_009698_4
NC_009698_5
NC_009698_6
NC_009698_7
NC_009698_8
NC_009698_9
NC_009699_12
NC_010516_5
NC_012563_3
NC_012563_5
NC_012563_6
NC_012658_4
NC_012658_5
NZ_CP006908_1
NZ_CP006908_2
NZ_CP006908_3
ATTTAAATACATCTCATGTTAATGTTCAAC
30

NC_008595_1
TGCTCCCCGCGCAAGCGGGGATGAACC
27

NC_008599_1
NC_008599_2
NZ_CM001228_1
NZ_CP006999_1
NZ_CP008808_1
NZ_CP008810_1
NZ_CP014568_1
NZ_HG004426_1
GTTTGCTAATGACAATGTTTGTGTTGAAAC
30

NC_008600_1
NC_012659_2
NC_016779_2
NC_017729_2
NZ_CM000716_1
NZ_CM000727_1
NZ_CM000739_3
NZ_CM000755_2
NZ_CM000757_3
NZ_CM002395_3
NZ_CM002398_2
NZ_CM002401_4
NZ_CP001970_2
NZ_CP001974_2
NZ_CP006742_2
NZ_CP007666_1
NZ_CP007704_5
NZ_CP008846_2
NZ_CP009315_3
NZ_CP009318_1
NZ_CP009328_5
NZ_CP009335_2
NZ_CP009341_5
NZ_CP009600_5
NZ_CP009641_7
NZ_CP009697_6
NZ_CP010322_5
NZ_CP010342_3
NZ_CP010792_2
NZ_CP010813_2
NZ_CP010852_3
NZ_CP012519_2
NZ_CP012720_2
NZ_CP012721_2
NZ_CP012722_2
NZ_CP012723_2
NZ_CP012724_2
NZ_CP012725_2
NZ_CP012726_2
NZ_CP012727_2
NZ_CP012728_2
NZ_CP012729_2
NZ_CP012730_2
NZ_CP013274_1
NZ_CP014179_2
NZ_CP015779_2
TGTATGATTACCTTCCGCATGAGAA
25

NC_008601_1
NC_017450_1
NZ_CP009353_2
NZ_CP009607_1
NZ_CP009633_4
NZ_CP010103_2
NZ_CP016635_1
CTAACAGTAGTTTACCAAATAATTCAGCAACTGAAAC
37

NC_008601_4
NC_010336_2
NC_017450_2
NZ_CP009343_2
NZ_CP009353_1
NZ_CP009436_2
NZ_CP009633_1
NZ_CP010103_1
NZ_CP016635_2
ATCTACAACAGTAGAAATTATTTAAAGTTCTTAGAC
36

NC_008607_1
GTCTCCACTACAAAGCGGCGGAGCACGCATGTCAAC
36

NC_008618_3
ATTTCAATCCACACATCCCGTATGGGATGCGAC
33

NC_008618_4
ATTTCAATCCACGCTCTCCGTAAGGAGAGCGAC
33

NC_008639_2
NC_008639_3
NC_011060_4
NC_014484_1
GTTTCAATCCACGCGCCCGCAGGGGGCGCGAC
32

NC_008639_4
NC_008639_5
GTTTCAATCCTCTATGAGTGCAATAAGATATAAAG
35

NC_008639_6
GTTTCAATCCCTCTTAATACGTCAGGTCTTAATCAAC
37

NC_008686_4
GTTTCGATCCACGCCCCCGCGAAGGGGGCGAC
32

NC_008698_1
NC_008698_10
NC_008698_3
NC_008698_9
GAAGCAACTGTGAAAGCATTGAAAG
25

NC_008698_2
NC_008698_4
NC_008698_6
NC_008698_7
NC_008698_8
CTCTTAGTCTTGCTGATTTTGAAC
24

NC_008698_5
CTTTCAACTCATTCGTTGTTGATAC
25

NC_008701_1
NC_008701_2
NC_008701_3
NC_008701_5
NC_010525_1
NC_010525_2
NC_010525_3
NC_010525_4
NC_010525_7
GTTTCTACTATCTTTTGATTTCTGG
25

NC_008701_4
GTTTCTACTATCTTTTGATTTCTG
24

NC_008709_8
NC_011138_1
GTGTTCCCCGTGCCCACGGGGATGAACCG
29

NC_008741_1
NZ_CP010311_1
GTTTCAATCCACGCCCCCGCACGGGGGGCGAC
32

NC_008750_5
TTTCTAAGCCGCCTGTGTGGCGGTGAAC
28

NC_008767_3
NC_017501_4
NC_017513_2
NC_017515_2
NC_017517_2
NZ_CP012392_2
NZ_CP016880_2
CGTCATTTCCGCGCAGGCGGGAATCC
26

NC_008782_1
NC_008782_2
NC_014836_1
NC_022444_4
NZ_CP012359_1
NZ_CP012371_3
NZ_CP014135_1
NZ_CP014135_2
TTTCTGAGCTGCCTATGCGGCAGTGAAC
28

NC_008786_1
ATTGTAGCTCACTGGGATATGCGCACTGGCCGGAAC
36

NC_008786_2
NC_008786_3
TTTCTGAGCTGCCTATCCGGCAGTGAAC
28

NC_008789_1
NC_008789_3
GTCTTAATCCCTTTTCCAACAGGGCTAGGTTCGGAC
36

NC_008818_1
NC_008818_2
GAACAACTCAAAAGAGAATTGCAAG
25

NC_008942_3
GTCGTGCCCCCCGTGGGCACGTGGATTGAAAT
32

NC_009009_1
NC_009009_2
NC_009009_3
GTTTCCGTCCCCTCCCGAGGTGACTGGGG
29

NC_009012_1
NC_017304_4
NZ_CP013828_4
NZ_CP015438_1
NZ_CP016502_4
GTTTGTATCGTACCTATGAGGAATTGAAAC
30

NC_009012_2
NC_009012_3
NC_017304_2
NC_017304_5
NZ_CP013828_2
NZ_CP013828_5
NZ_CP016502_2
NZ_CP016502_5
GTTTTTATCGTACCTATGAGGAATTGAAAC
30

NC_009012_4
GTTGAAGTGGTACTTCCAGTAAAACAAGGATTGAAAC
37

NC_009012_5
NC_017304_1
NZ_CP013828_1
NZ_CP016502_1
GTTGAAGAGGTACTTCCAGTAAAACAAGGATTGAAAC
37

NC_009033_1
NC_009033_11
NC_009033_3
NC_009033_5
NC_009033_6
NC_009033_7
NC_009033_8
NC_009033_9
CTTTCAATTCTTTCTATGTTGTTAC
25

NC_009033_10
CTTTCAATTCTTTCTGTGTTGCTAC
25

NC_009033_12
CTTTCAATTCTTTCTGTGTTGTTAC
25

NC_009033_4
GTAGCAACATAGAAAGAATTGAAAG
25

NC_009051_1
TCGAAGACCTTCGGTCTTCTCGAACTCC
28

NC_009053_1
NC_010278_1
NC_010939_1
NZ_CP007715_2
NZ_LN908249_1
TTTCTAAGCTGCCTATACGGCAGTGAAG
28

NC_009073_1
NC_009073_2
NC_009073_3
GAGAATCCCCAAAGGGGGTAGAAA
24

NC_009073_4
NC_009073_5
NC_009073_6
NC_009073_7
CTTTCAATCCTCTTCTTGAGATTC
24

NC_009089_10
NZ_CM000604_7
NZ_CP010888_11
NZ_CP010905_10
NZ_LN614756_10
CTTTACATACCACATAGTTGATATAAAAC
29

NC_009089_11
NC_009089_15
NC_009089_16
NC_009089_3
NC_009089_4
NC_013315_13
NC_013316_13
NC_013974_7
NC_013974_8
NC_017173_7
NC_017173_8
NC_017178_13
NC_017179_13
NZ_ABHD02000050_1
NZ_ABHD02000050_2
NZ_CM000441_12
NZ_CM000657_12
NZ_CM000658_12
NZ_CM000659_11
NZ_CM000661_12
NZ_CP010905_11
NZ_CP010905_15
NZ_CP010905_16
NZ_CP010905_3
NZ_CP010905_4
NZ_LN614756_11
NZ_LN614756_15
NZ_LN614756_16
NZ_LN614756_3
NZ_LN614756_4
ATTTACATTCCATATAGTTAATCTAAAAC
29

NC_009089_12
NC_009089_8
NC_013315_12
NC_013316_12
NC_013974_11
NC_013974_14
NC_017173_12
NC_017173_6
NC_017175_12
NC_017175_6
NC_017175_7
NC_017178_12
NC_017179_12
NZ_CM000441_11
NZ_CM000604_5
NZ_CM000604_9
NZ_CM000637_3
NZ_CM000637_6
NZ_CM000657_11
NZ_CM000658_11
NZ_CM000659_10
NZ_CM000661_11
NZ_CP010888_13
NZ_CP010888_9
NZ_CP010905_12
NZ_CP010905_8
NZ_LN614756_12
NZ_LN614756_8
ATTTACATTCCATATAGTTAATATAAAAC
29

NC_009089_17
NC_009089_7
NC_013315_11
NC_013315_19
NC_013316_11
NC_013316_19
NC_013974_10
NC_013974_12
NC_013974_17
NC_013974_18
NC_017174_7
NC_017178_11
NC_017178_19
NC_017179_11
NC_017179_19
NZ_CM000441_10
NZ_CM000441_18
NZ_CM000604_12
NZ_CM000604_4
NZ_CM000604_6
NZ_CM000637_10
NZ_CM000637_2
NZ_CM000637_4
NZ_CM000637_9
NZ_CM000657_10
NZ_CM000657_18
NZ_CM000658_10
NZ_CM000658_18
NZ_CM000659_17
NZ_CM000659_9
NZ_CM000660_7
NZ_CM000661_10
NZ_CM000661_18
NZ_CP010888_15
NZ_CP010888_8
NZ_CP010905_17
NZ_CP010905_7
NZ_LN614756_17
NZ_LN614756_7
ATTTACATACCACTTAGTTAATATAAAAC
29

NC_009089_6
NC_013315_10
NC_013316_10
NC_017174_12
NC_017174_3
NC_017178_10
NC_017179_10
NZ_CM000441_9
NZ_CM000604_3
NZ_CM000657_9
NZ_CM000658_9
NZ_CM000659_8
NZ_CM000660_12
NZ_CM000660_3
NZ_CM000661_9
NZ_CP010888_7
NZ_CP010905_6
NZ_LN614756_6
GTTTTATATTAACTAAGTGGTATGTAAAG
29

NC_009089_9
NC_013315_15
NC_013316_15
NC_013974_6
NC_017173_10
NC_017174_5
NC_017175_10
NC_017178_15
NC_017179_15
NZ_CM000441_14
NZ_CM000637_1
NZ_CM000657_14
NZ_CM000658_14
NZ_CM000659_13
NZ_CM000660_5
NZ_CM000661_14
NZ_CP010888_10
NZ_CP010905_9
NZ_LN614756_9
GTTTTATATTAACTATGTGGTATGTAAAT
29

NC_009135_3
NC_015847_3
CTAAAAGAATAACTTGCAAAATAACAAGCATTGAAAC
37

NC_009142_10
NC_009142_9
CTGTCACCGGCGCCAAGCGTCGGTCCTCATTGCGGC
36

NC_009142_6
CTCGCCGTCCCCGCCGGGACGGCCCTTCATT
31

NC_009142_8
CCGTCACCGACGCGCAGCGTCGGTCCTCATTGCGGC
36

NC_009253_2
GTTATCAGCCTACCTATAAGGAATTGAAAC
30

NC_009253_3
NC_009253_4
NC_014365_2
NC_018025_2
GTCGCCCCTCACGCAGGGGCGTGGATTGAAAC
32

NC_009253_5
NC_009253_6
GTCAAAACACAAAATAATTCCCTTTGGGAATTGAAAC
37

NC_009328_1
NC_009328_2
NC_009328_3
GTTTGTATCGTACCTATGAGGGATTGAAAC
30

NC_009337_1
NC_009337_2
GTCGCGCCCTTCACGGGCGCGTGGATTGAAAC
32

NC_009342_4
GGAAATACCTCCGCGTGTGCGGAGAAGAG
29

NC_009376_5
CAAAATCAAAAGATAGTTGAAAC
23

NC_009380_2
NC_013510_6
NC_013510_7
GTTGCGATCCCTCCAGGGGTGATGAGCGAC
30

NC_009380_3
GGTCGCTCATCACCCCTGGAGGGATCGCAAC
31

NC_009380_5
GCACCCCCACGTGCGTGGGGAGGAC
25

NC_009437_1
NC_009437_5
NC_015949_11
NC_015949_12
GTTTCAATCCCCAAAGGGCAGGCTACAAAC
30

NC_009437_10
NC_009437_11
NC_009437_12
NC_009437_7
NC_009437_8
NC_009437_9
NC_014721_9
GTCTTATCTGAACTATGAGGGATGTAAAC
29

NC_009437_13
GGTTAAGTTTACACCCCTCATAGTTCAGATAC
32

NC_009437_2
GTTTCAGTCCCCAAAGGGGAGGCTACAAACA
31

NC_009437_3
NC_012034_4
NC_014652_3
NC_014657_3
NC_014721_7
NC_015949_10
NC_015949_2
NC_015949_4
NC_015949_6
GTTTCAATCCCCAAAGGGAAGGCTACAAAC
30

NC_009437_4
GTTTCAATCCCCAAAGGGGAGGCTA
25

NC_009437_6
GTTTCAATCCCCAAAGGGTAGGCTACAAAC
30

NC_009438_1
NC_009446_1
NC_009665_2
NC_009997_2
NC_016901_2
NC_017566_5
GTTCACCGCCGCACAGGCGGCTTAGAAA
28

NC_009439_2
NC_009439_3
NZ_HG916826_2
NZ_HG916826_3
NZ_LK391695_2
NZ_LK391695_3
CGGTTCATCCCCGCTGGCGCGGGGAACAC
29

NC_009440_2
NZ_CP008822_2
NZ_CP012172_2
NZ_CP012173_2
NZ_CP012174_2
NZ_CP012175_2
NZ_CP012176_2
CTTTCAACTCTATAGGAGATTAAC
24

NC_009440_3
NZ_CP008822_3
NZ_CP012172_3
NZ_CP012173_3
NZ_CP012174_3
NZ_CP012175_3
NZ_CP012176_3
CTTAATCTCCTATAGAGTTGAAAG
24

NC_009440_4
NZ_CP008822_4
NZ_CP012172_4
NZ_CP012173_4
NZ_CP012174_4
NZ_CP012175_4
NZ_CP012176_4
GTTAATCTTCTATAGAGTTGAAAG
24

NC_009440_5
NZ_CP008822_5
NZ_CP012172_5
NZ_CP012173_5
NZ_CP012174_5
NZ_CP012175_5
NZ_CP012176_5
GTTTCAAACCCTCGAAGGATCTCTACAAAC
30

NC_009454_2
NC_009454_3
NC_009454_4
NC_009454_5
GTTTCAATTCCTCATAGGCAGGCTAAAAAC
30

NC_009454_6
NZ_CP009241_6
GTTTCAATCCACGCTCCCGCACGGGGAGCGAC
32

NC_009455_1
NC_020386_1
GTTTCAATTCACGCTCCCGCACGGGGAGCGAC
32

NC_009457_1
NC_012582_1
GTCTTCCCCACGCAGGTGGGGGTGTTTC
28

NC_009468_1
NZ_CP007511_4
NZ_CP010430_5
GTGTTCCCCGCAGGCGCGGGGATGAACCG
29

NC_009470_1
CCGTTCCCCGCGCACGCGGGGATGAACCG
29

NC_009483_1
CTGTTCCCCGCACGAGCGGGGATGAACCG
29

NC_009483_4
GTTTCAATCCTCACCCGCCATTGAAGGCGGGCGCTTC
37

NC_009486_1
NC_009486_2
NC_009486_3
NC_010483_1
NC_010483_2
NC_010483_3
NC_010483_5
NC_013642_1
NC_013642_2
NC_013642_4
GTTTCAATAGTTCCTTAGAGGTATGGAAAC
30

NC_009486_5
NC_011978_5
NC_013642_5
NZ_CP007633_4
GTTCATATTCCTCTTAGGAAGATAAAAAC
29

NC_009495_11
NC_009697_11
NC_009698_11
ATTTAAATACATCCTATGTTAATGTTCAAC
30

NC_009515_2
ATTTCAATCCTATTATAGTCTTATTTTTAAC
31

NC_009523_2
GGGCAAAGCCCGCCTGCGCGGGCTAGA
27

NC_009523_31
NC_009523_50
NC_009523_55
GGCAAAGCCCGCCTGCGCGGGCTA
24

NC_009523_33
NC_009523_34
ATTTCGGCAATTTCGACTCGTTGAAGAGTACTGAAAC
37

NC_009523_37
ATAGCCCGCGCAGGCGGGCTTTGC
24

NC_009523_38
GTTTCAGTGCTCTTCAGCGAGCCGAAAATTCCTCAAT
37

NC_009523_47
NC_009523_59
GAAGCGACCACTGCCCCGCAATGAAGGGGATTGAAAC
37

NC_009523_52
TTACTCAAAGACCATAAGCCCTCGGCTA
28

NC_009523_60
CACCGCTCCTCGCGCACGCGGTTACAGCG
29

NC_009523_7
CGGTTCACCCCCACGGGCGTGGGGACAAT
29

NC_009523_86
GTTTCAATCCACGCCTTCCGGGGGGAAGGCGAC
33

NC_009524_1
NZ_CM003594_2
NZ_CP012533_1
TTTCTAAGTCACCTATGCGGTGATGAAG
28

NZ_CP007207_3
NZ_CP007627_2
NZ_CP010275_2
NZ_CP010277_2
CAATAGAAGTTACAGAATTAGGAAT
25

NC_009613_3
NZ_CP007627_7
NZ_CP008878_3
NZ_CP008881_2
NZ_CP008883_2
NZ_CP008902_2
NZ_CP010274_2
NZ_CP010275_3
NZ_CP010276_2
NZ_CP010277_3
NZ_CP010278_2
GTTGGTAATTATAAGCTAAAATACAATTTTGAAAGCAATTCACAAC
46

NC_009615_1
GTCGCACCCCGTGTGGGTGCGTGGATTGAAAC
32

NC_009616_1
GTTTCTACCTTACCTTGGAGGAATTGAAAC
30

NC_009616_2
ATTTCAATTCCTCCAAGGTAAGGTAAAAAC
30

NC_009616_3
ATTTCTATTCCTCATAGGTAGATTCTAAAC
30

NC_009616_4
NC_009616_5
GTTTAGAATCTACCTATGAGGAATGGAAAC
30

NC_009633_8
GTCGCTCCCTATATGGGGGCGTGGATTGAAAT
32

NC_009633_9
CCTTTAATTGAACTAGAGTAGAATGTAAAT
30

NC_009634_1
ATACGAAACGTTGATCCATCAAAACAAGGATTGAGAC
37

NC_009634_3
GTTTCAATGCTTGTTCTAATGCATTATGCTCTTTTAC
37

NC_009635_4
GTCTAAAAGACACATCCATTAAAACAAGGATGGAAAC
37

NC_009654_2
TTTCTAAGCCGCGTGCTCGGCGGCGAAC
28

NC_009654_4
CGGTTTATCCCCGTGTGCTCGGGGAACGC
29

NC_009655_1
NC_015964_1
NC_018690_2
NZ_CP009159_2
ATTATAGCACTGCGAAATGAAAAAGGGAGCTACAAC
36

NC_009655_2
GCAGCCGCCTTCAGGCGGCTGTGTGTTGAAAC
32

NC_009674_2
NC_009674_3
NC_012793_6
NC_014650_7
NC_015185_1
NC_015660_5
NZ_CP010976_1
NZ_CP010976_2
NZ_CP012024_10
NZ_CP012024_11
NZ_CP014140_6
CTTTATATCCCACTACGTTCAGATAAAAC
29

NC_017297_4
ATAATAATATAAAAGATATATCT
23

NC_009699_1
NC_012563_1
NC_017297_1
TGAACATTAACATGAGATGTATTTAAAT
28

NC_009699_10
NC_009699_13
NC_009699_8
NC_009699_9
NC_012658_3
NC_017299_7
NZ_AP014696_10
ATTTAAATACATCTTATGTTAATGTTCAAC
30

NC_009699_11
TTTAAATACATCTTATGTTAATGTTCAAC
29

NC_009699_14
NC_017297_14
CAAATTTAAATACATCTTATGTTAATGTTCAAC
33

NC_009699_2
NC_017297_2
GTTGAACATTAACATGAGATGTATTT
26

NC_009699_5
NC_009699_6
NC_009699_7
NC_017297_5
NC_017297_6
NC_017297_7
NZ_AP014696_2
NZ_AP014696_3
NZ_AP014696_4
NZ_AP014696_6
NZ_AP014696_7
NZ_AP014696_8
ATTTAAATACATCTTATGTTACTGTTCAAC
30

NC_009706_2
NC_011837_2
ATTTAAATACAATCCTTGTTAAGGTTCAAC
30

NC_009706_3
NC_009706_4
NC_011837_3
NC_011837_4
ATTTAAATACAATCCTTGTTAAAGTTCAAC
30

NC_009706_5
NC_011837_5
ATTTAAATACAATTCTTGTTAAGGTTCAAC
30

NC_009706_6
NC_011837_6
ATTTAAATACAAATCTTGTTAAGTTTCAAC
30

NC_009714_1
ATTTCAATACAAAATTTGTTATAGCAAAAT
30

NC_009715_1
GTTTCAAATTCCAACGGAATGATCTTTAAT
30

NC_009715_2
AAATTCCAACGGAATAAATTTTAAC
25

NC_009718_1
GCTTTTAGCATACCTATTAGGGATTGAAAC
30

NC_009718_2
NC_017095_2
NC_017095_4
NC_017095_6
NZ_CP011393_1
NZ_CP011393_3
GTTTTAGAAGTGACTATGAGGGATGGAAAC
30

NC_009719_1
GCTGCGGATTGCGGCCGTCTCTCGATTTGCTACTCT
36

NC_009767_24
GTCGCCTTCCCCCCGGAAGGCGTGGA
26

NC_009767_33
GTTTCAGTGCTCTTCTGCGAGCCGAAAATTCGGAAAT
37

NC_009767_37
CGTAAGGGCAGGTCTGAGACCTGCCC
26

NC_009767_45
GTGGAAAAACCCCAAATCCCCGCCAGGGGATTGAAAC
37

NC_009767_57
CCTGAACCCTCCCGCGCGCGGGGGG
25

NC_009767_62
GTTTCAATCCCCTTCATGGCGGGGCTTTTGTTTTTTT
37

NC_009767_78
TTTCCGATTTTTCGGCTCGCAGAAGAGCACTGAAAT
36

NC_009776_1
NC_009776_8
CTTTCTATCCTCTCTTGAGACTCCAC
26

NC_009776_10
CTTTCTATCCTCTTTTGAGACTTCAC
26

NC_009776_11
GACCTTTCTATCCTCTCTTGAGACTCCAC
29

NC_009776_12
TGGAGTCTCAAAAGAGGATAGAAAG
25

NC_009776_2
NC_009776_3
NC_009776_4
NC_009776_5
NC_009776_6
CTTTCTATCCTCTTTTGAGACTCCAC
26

NC_009776_7
GTGGAGTCTCAAGAGAGAATGGAAAG
26

NC_009776_9
GATTAAACGAAAGAGAACTGCAAG
24

NC_009778_10
NC_013282_2
NC_017933_16
NC_020260_12
NC_023032_12
NZ_CP012253_12
NZ_CP012257_4
NZ_CP013940_12
CGGTTTATCCCCGCTCGCGCGGGGAACAG
29

NC_009778_9
NC_017933_15
NC_020064_1
NC_023032_11
NZ_CP011602_1
NZ_CP012266_3
NZ_CP012266_4
NZ_CP013940_11
CGGTTTATCCCCGCTCGCGCGGGGAACAC
29

NC_009784_1
NC_022270_2
GTAAACTGCCGAGTAGGTAGCTGATAAT
28

NC_009792_10
TTTCTAAGCTGCCTGTACGGCAGTGAACA
29

NC_009800_6
CGGTTTATCCCCGCAGGCGCGGGGAACTC
29

NC_009801_1
NC_011741_2
NC_016822_2
NC_017328_3
NZ_CM001474_2
NZ_CP004056_2
NZ_CP004057_2
NZ_CP007037_2
NZ_CP009104_1
NZ_CP010344_4
NZ_CP010829_2
NZ_CP011018_3
NZ_CP012137_2
NZ_CP012140_4
NZ_CP012735_5
NZ_CP013029_3
NZ_CP013662_5
NZ_CP014099_3
NZ_CP014583_2
NZ_CP014670_6
NZ_LM651928_2
GTTCACTGCCGTACAGGCAGCTTAGAAAT
29

NC_009828_1
NC_009828_2
NC_022792_1
NC_022792_2
NC_022792_3
NZ_AP014509_2
GTTTCCATCCCTCTAAGGTTCGATTGAAAC
30

NC_009925_1
CTTTCAACCCCCAACACCCTCAAAAGGACGTTGCGAC
37

NC_009943_1
GTCGCAATCCCCTCTAACAGCGGGTCTCTTCCTTC
35

NC_009943_9
ATGTTCCCCACACGTGTGGGGATGAACCG
29

NC_009952_2
NZ_CP010855_2
AGTTTAGCTGTTCAGAATTCGGGGTCCAGCCGCAAC
36

NC_009952_3
GGCTCCCCCGCCCCCGCGGGGATAGACCC
29

NC_009953_10
GGATCACCCCCGCGTGTGCGGGGAACAG
28

NC_009953_2
NC_009953_3
NC_009953_4
CGGAGCACCCCCACGTGCGTGGGGAGGAC
29

NC_009953_5
GGATCACCCCCGCCTGCGCGGGGAACAG
28

NC_009953_6
NC_009953_7
CTGCTCCCCGCGCATGCGGGGGTGATCCC
29

NC_009953_9
CCTTCACCGACCCAACGCGGTCGGTCTCCGTTGCGGG
37

NC_009972_10
GTTTTAATCCCCCAGAGAGGATTCAGGTCTTTCGAATA
38

NC_009972_11
GTTTTAATCCCCCAGAGAGGATTCAGGTCTTTCGAAT
37

NC_009972_15
GTTTTAATCCCTTGTAAGGATTCTTTAGTTATGGAAC
37

NC_009972_19
CTTGGAATGGCCTTAATCCTTTGGCAGGGATTTAAAC
37

NC_009972_21
GTTCCATAAATAAAGAATCCCTACAAGGGATTAAAAC
37

NC_009972_22
NC_009972_23
ATTTCAATCAACGCCCCGAGGAAGAGGGGATTAAAAC
37

NC_009972_24
ATTCAAATAACCAAAATCCTCGGAAGGGGATTAAAAC
37

NC_009972_9
CTTAGAATGGACACAATCCTCTGGCGGGGATTAAAAC
37

NC_009973_2
NC_009973_3
ATTTCAATTACTCGATCCGATTAGAGGATACTGAAAC
37

NC_009973_4
GTAAGAATCATCGCCCCGACGAAGAGGGGTTTAAAAC
37

NC_009973_5
GTTTCAAAACCCTCGTCGTCGGGCCACCCTATCAAAC
37

NC_010002_1
NC_015563_3
GTTCGCTGCCGCGTAGGCAGCTCAGAAA
28

NC_010003_4
NC_010003_5
CTTTTTATCCTACCTATGAGGAATGGAAAC
30

NC_010080_2
TAGGATCACCTCCACATACGTGGAGAATAC
30

NC_010080_3
NC_017467_1
NC_018528_1
NZ_CP012381_1
NZ_CP012475_11
ATTTCAATCCACGCACTCACAAGGAGTGCGAC
32

NC_010085_1
CCATTCCTCTCAAGTAACGCAACA
24

NC_010102_1
CGGTTTATCCCCGCTGGCGCGGGAAACAC
29

NC_010102_2
NC_020163_4
NZ_CP007442_4
NZ_CP012038_1
NZ_CP013029_5
NZ_CP013112_3
CGGTTTATCCCCGCTGGCGCGGGGAACACA
30

NC_010125_1
NC_011365_3
NC_011365_4
GTTTCAATCCACGCTCCCGCACAGGGAGCGAC
32

NC_010125_2
NC_011365_1
AGCCTACCATCGGCAAATCGGTAGGGAAACCACGGC
36

NC_010125_3
NC_011365_2
CGGTTCATCCCCGCACGTGCGGGGAACAC
29

NC_010162_1
NC_010162_20
NC_010162_21
NC_021658_2
NC_021658_28
NC_021658_34
CTCTCCGCCGCTGAAAGGCGGCGGCCCCATTGAAGC
36

NC_010162_24
GTTTCAATGCCCTTTGAGCAGGCATGTCCCGTTCGGG
37

NC_010162_32
GCGATCCCCGCCGTGATGCCGGAAGGCGTTGAGCAC
36

NC_010175_22
NC_012032_23
CTTTCAACAATTTCGGCTCACGGTAGAGCACTGAAAC
37

NC_010175_25
NC_012032_26
CAGCAGAGCATTGCCCCGCAATGAAGGGGTTTGAAAC
37

NC_010175_3
NC_012032_3
GTTTCAATCCCCTCGCGGGGATTTTGGTTTTTTGAAG
37

NC_010296_19
NC_010296_20
NC_010296_21
NZ_CP011304_20
NZ_CP011304_21
NZ_CP011304_22
NZ_CP011304_23
NZ_CP011339_29
NZ_CP012375_19
NZ_CP012375_20
NZ_CP012375_21
NZ_CP012375_22
GTTCCAATTAATCTTAAACCCTATTAGGGATTGAAAC
37

NC_010296_37
CCTTACCTATTAGGTCAAATAGGATTAGTTGGAAA
35

NC_010320_1
NC_014538_1
GTTTTTAGCTTACCTATAAGGGATTGAAAC
30

NC_010320_2
NC_010320_3
NC_010320_4
NC_010321_2
NC_010321_3
NC_010321_4
NC_010321_5
NC_010321_6
NC_010321_7
NC_010321_8
NC_013921_1
NC_014209_2
NC_014209_3
NC_014538_2
NC_014538_3
NC_014538_4
NC_014964_2
NC_014964_3
NC_014964_4
NC_014964_5
NC_014964_6
NC_015555_2
NC_015958_4
NC_017992_1
NC_017992_4
NZ_CM001486_2
NZ_CM001486_3
NZ_CM001486_4
NZ_CM001486_5
NZ_CP009170_4
GTTTCAATTCCTTATAGGTAGGCTAAAAAC
30

NC_010337_2
ATGTTCCCCGCGTGCGCGGGGGTGTACCG
29

NC_010337_4
GTTTCACTGGATGACCCGCTATGTAGGGGATTGAAAG
37

NC_010337_5
GTTTCACTGGATGACCCGCTATGTAGGGGATTGA
34

NC_010371_2
NC_010371_3
AGGAACACCCCCGCATGTGCGGGTAAAA
28

NC_010371_4
AACACCCCCGCTTGTGCGGGTAAAA
25

NC_010376_1
GTTTGAGAATGATGTAATTTCATATAGGTATTAAAC
36

NC_010379_1
NC_010379_4
GTTTAACTTCTACATTATATGTATTTAAA
29

NC_010379_2
NC_010379_3
NC_010418_4
NC_010418_5
AAAAAGTGTTTCACTTTTGTCGTGCACTTTT
31

NC_010381_1
NZ_CP014644_1
NZ_CP014857_1
ATTTCAATCCACGCTCCCCTAAGGAGAGCGAC
32

NZ_CP015224_1
TTTTAATTAAACTTTATTTTAAA
23

NC_010410_2
NC_011586_4
NC_011595_3
NZ_CP008706_2
NZ_CP010781_3
NZ_CP012952_2
NZ_LN865143_1
NZ_LN997846_1
GTTCATGGCGGCATACGCCATTTAGAAA
28

NC_010418_1
NC_010418_2
NC_010418_3
GTTTAACTTCTACATTAGATGTATTTAAAC
30

NC_010424_2
CTTTCAGTCCCCTTTTCGTCGGGTCGGTCGCTGAAAC
37

NC_010424_4
NC_010424_5
NC_010424_6
GTTTCAATCCCTCGTAGGTAGGCTGGAAAC
30

NC_010465_4
NZ_CP008943_3
NZ_CP009759_3
NZ_CP009792_4
TAAGCTGCCTGTACGGCAGTGAAC
24

NC_010475_1
NZ_CP007544_1
GTGTCCAAACCATTGATGCCGTAAGGCGTTGAGCAC
36

NC_010478_1
GTTTCAGTCCCGTAATCGGGATTTAGTGGTTGGAAAG
37

NC_010480_1
GTTTCCAATCTATTTGCTTCTCAGGTGAAGAGAAAC
36

NC_010482_2
TCTTTCAATCCTCTTTTCATCGAGAC
26

NC_010482_3
GTCTCGATGAAAAGAGGATTGAAAG
25

NC_010498_3
CGGTTTATCCCCGCTGGCGCAGGGAACAC
29

NC_010511_12
NC_010511_15
ATCGCCCCCTCGCGGGGGCGCGGATTGAAAC
31

NC_010511_34
GTTTCAATCCGCACCCCCGTGAGGGGGGTGAAC
33

NC_010516_1
NC_010516_2
GCTGAACATTAACATGAGATGTATTTAAAT
30

NC_010516_4
NC_017297_10
NC_017297_11
NC_017297_8
NC_017297_9
TTAAATACATCTTATGTTAATGTTCAAC
28

NC_010516_6
ATTTAAATACATCTCATGTTAATGTTCAA
29

NC_010524_1
GTTTCAATCCACGCCCGCCAGTTTCCCGGCGAGCGAC
37

NC_010525_10
NC_010525_5
NC_010525_8
GAATCTCAAGTTGAGGATTGAAAG
24

NC_010525_6
GATTCTCAGATAGAGATTTGAAGG
24

NC_010525_9
NC_016070_4
NC_016070_5
NC_016070_7
CTTTCAATCCTCTCTTTGAGATTC
24

NC_010545_5
GGCTCATCCCCGCTGGCGCGGGGA
24

NC_010546_1
TTCAACTAAGTTCTCTTATTAAAAGAGAG
29

NC_010546_12
NC_010546_3
CTCTCTTTTTATAAGAGAACTTAGTTGAATGGAAAC
36

NC_010546_2
GTTTCCATTCAACTAGGTTCTCCGTTAAGAGAAAG
35

NC_010546_4
TATGGCCTAACCTTTGATGCCGTAAGGCGTTGATCAC
37

NC_010556_1
NZ_CP008855_2
NZ_CP008855_3
GTCGCACTCCTCGTGAGTGCGTGGATTGAAAT
32

NC_010572_7
NC_010572_8
GTGGTCCCCGCGCGTGCGGGGGTGTTCCC
29

NC_010572_9
GTGGTCCCCGCGCGTGCGGGGTTGTTCC
28

NC_010610_2
NC_010610_3
NC_017465_2
NC_017465_3
NZ_CP011013_3
GTATTCCCCATGTATGTGGGGGTGATCCT
29

NC_010610_5
NC_017465_5
ATTTCAATCCACGCACCCCCGCGAAGGAGTGCGACC
36

NC_010612_8
NZ_HG917972_7
NZ_HG917972_8
TGTTTGGCAACGGCGGAGCCGGCGG
25

NC_010628_16
GTTTCAATCCCTGATAGGGATTTTGATGAATTGCAAT
37

NC_010628_28
CTTTCAACCCACCCAGTACCTGGAGGGTTGTTGCCAC
37

NC_010628_32
GTTTCAATCCCTAATAGGGATTTTGATGAATTGCAAT
37

NC_010628_4
GTTGCAAAACACCTCATCCCTGATAGGGATTCAA
34

NC_010628_6
ATTGCAATTTATCAAAATCCCTATTAGGGATTGAAAC
37

NC_010628_8
GTTTCAATCCCTAATAGGGATTTTGAGAAATTGCAAT
37

NC_010634_3
NZ_CP009757_1
NZ_CP009780_1
GTTCACTGCCGCACAGGCAGCTTA
24

NC_010644_1
ATTCTATAAAATCAATTCTCGGAGGGCAACCCTAAC
36

NC_010655_1
GTTTTGCCTTGAATCCAAAATAAGGCACAGTACAAC
36

NC_010655_2
NZ_CP015409_1
GTTTCAATCCACGCACTCCTTGCGGAGTGCGAC
33

NC_010674_2
NC_018648_2
ATTTAAATACATCTCATGTTAAGGTTAATC
30

NC_010694_4
GTTCACTGCCGTACAGGCAGCTTAGAAG
28

NC_010723_2
NZ_CP010520_2
NZ_CP010521_2
GATTAACCTTAACATGGGATGTATTTAAAT
30

NC_010723_3
NZ_CP010520_3
NZ_CP010521_3
GTTTAACCTTAACATGAGATGTATTTAAATA
31

NC_010723_4
NZ_CP010520_4
NZ_CP010521_4
GATTAACATTAACATGGGATGTATTTAAAT
30

NC_010730_1
NC_010730_3
CTTTATAACCCACACGGTTCAGATGTAAC
29

NC_010730_6
GGTTACATCTGAACCGTGTGGGTTATAAAG
30

NC_010794_1
NC_010794_2
NC_010794_3
NC_010794_4
NC_010794_5
GTTTCAAGCCCAGTGCACTGGGATACATCATCAAC
35

NC_010803_2
CTTATAATTGCACCAATATGGAATTGAAAC
30

NC_010803_3
NC_010803_4
NC_010803_5
CTTTATATCTAATTGCACTCATTGAGGATTGAAAC
35

NC_010814_1
CGGTTCATCCCCGCGGGTGCGGGGAACGG
29

NC_010816_5
NC_017221_2
NZ_AP014658_4
NZ_CP010453_3
CAAGCTTATCAAGAAGGGTGAATGCTAATTCCCAGC
36

NC_010831_1
GTAGGAAGACCCGATTAGCTACAGGGGATTGAGAC
35

NC_010831_11
NC_011059_1
GTCTTCCCCACAGGCGTGGGGGTGTTTC
28

NC_010831_13
GTTTCAATTCTCCATGAGTGCGATTAGAT
29

NC_010831_2
NC_011059_5
NC_011059_6
GTAGATGAAGACCCGCTTGGATAAAGGGGATTGAGAC
37

NC_010995_4
GTTTCAATCCACGCGCTCGCGAAGAGCGCGAC
32

NC_010999_1
NC_014334_6
NC_017473_1
NC_017474_1
NC_018641_1
NC_021721_7
NC_022112_4
NZ_CM001848_1
NZ_CM001861_1
NZ_CP012148_3
GCTCTTGAACTGATTGATTCGACATCTACCTGAGAC
36

NC_011025_1
ACTTTTGGACTGTACAATTTTTATATAGAGTAAAGT
36

NC_011026_7
NC_011026_8
GTTTCAATTCCACATTGGTGCAATTAGATG
30

NC_011027_1
GTCGCAATACGCTAAAGCGTGCAATGAAATGAAAT
35

NC_011035_7
NC_011035_8
NZ_CP012028_5
NZ_CP016016_7
NZ_CP016016_8
CCGTCATTCCCGCTCAGGCGGGAATC
26

NC_011059_3
GTCTCAATCCCCCTTACTCAATCGGGTCTTCCTACAC
37

NC_011059_4
GTCGCAATCCCCTGTAGCTAATCGGGTCTTCAAAC
35

NC_011060_6
NC_011060_7
CATCATATCTTATTGCACGCATAGCGGATTGAAAC
35

NC_011126_4
NC_015557_8
NC_015587_8
NC_020411_8
NC_020814_8
GTTTTGTTTGTACCTATAGGGGATTGAAAC
30

NC_011134_1
GTCTCGCCCCATACGGGCGAGTGGATTGAAAT
32

NC_011134_4
GTTTTGGAACCATTCAATACAGCATAACTCTAAAAC
36

NC_011145_2
NC_011145_3
NC_011891_2
NC_011891_3
GGCTTCCCCGCGTGCGCGGGGATCGACCC
29

NC_011205_1
NC_021984_1
NZ_CM001151_1
NZ_CP014197_1
CCGGTTTATCCCCGCTGGCGCGGGGAACAC
30

NC_011274_1
NC_016831_1
NC_016831_2
NC_021984_2
NC_022221_1
NC_022221_2
NZ_CM001153_1
NZ_CP012346_3
NZ_CP012347_1
NZ_CP012347_2
NZ_CP013222_2
GTTTATCCCCGCTGGCGCGGGGAACAC
27

NC_011283_3
TGTCTTCCCCACATGCGTGGGGGTGTTTCTA
31

NC_011295_3
GTTTCAATCCCTTGTAGGTAAGCTAGAAAC
30

NC_011296_1
TCGCAATCCCTTTTAAATGAGGTCTTGTTTTCCAAC
36

NC_011296_2
GTAGGAAACAAGACCTCATTTAAAAGGGATTGCGAC
36

NC_011296_3
NZ_AP014945_1
NZ_AP014945_2
NZ_CP013015_7
GTTTTGAGCCTACCTATGAGGAATTGAAAC
30

NC_011296_4
GTTGGAAAACAAGACCTCATTTAAAAGGGATT
32

NC_011296_5
CTTTATATCCCACATGGTTCAGATGAAAC
29

NC_011297_1
NC_011297_3
GTTTGTAGCGTGCCTATAAGGGATTGAAAC
30

NC_011297_2
GTTTAAATCCCACATAGTTCAGATCAAAC
29

NC_011353_3
NC_013008_3
NC_017906_3
NZ_CP008805_3
NZ_CP008957_3
NZ_CP010304_3
NZ_CP012802_5
NZ_CP015020_4
NZ_CP015023_2
NZ_CP015842_3
NZ_CP015843_3
NZ_CP015846_3
NZ_CP016625_3
GGTTTATCCCCACTGGCGCGGGGAACTC
28

NC_011420_2
CTTCCTCGGCCCCTCGGGCCGAGGCCTCATTGAAGC
36

NC_011420_3
GCTTCAATGAGGCCCCGGCATTTCTGCCGGGGAAAG
36

NC_011420_4
NC_011420_5
NC_011420_6
NC_011420_7
GGGTTCATCCCTGCGGGGGCAGGGGCGAC
29

NC_011420_8
CCGCAGCCCTCTCCCCGCTACCGAGGGGACTGAAAC
36

NC_011529_1
NC_018015_4
NZ_CP015520_4
GTTTCAATTCTCCTAGAGTCTTATTGCAAC
30

NC_011529_2
NZ_CP006965_2
GTTTCAATAAGACTCTAAGAGAATTGAAAG
30

NC_011529_3
GTTCCAGTAGGACAGAATTGTGTGGAAAG
29

NC_011529_4
GTTTCAGTAGGACAGAATTGTGTGGAAA
28

NC_011566_3
GTGAACTGCCGAATAGGCAGCTGAAAA
27

NC_011567_1
ACGTTTGTATCGTACCTATGAGGAATTGAAAC
32

NC_011567_2
NC_011567_3
NZ_CP012152_3
GTTTTATCTGAACGTAGTGGGATGTAAAG
29

NC_011653_1
NC_011653_11
NC_011653_2
NC_011653_3
NC_011653_4
NC_011653_5
NC_011653_6
NC_011653_7
GTTTAGAATCTACCTATGAGGAATGAAAAC
30

NC_011653_10
GTTTCAATCCCTAATAGGTATGCTAAAAAC
30

NC_011653_12
ATTTCAATTCCTACAAGGTAAGGTACAAAC
30

NC_011653_8
ATTTCAATTCCTGCAAGGTAAGGTACAAAC
30

NC_011653_9
GTTTCAATTCCTACAAGGTAAGGTACAAAC
30

NC_011660_1
NC_017529_2
NC_017537_2
NC_017545_2
NC_017547_2
NC_018587_2
NC_018591_2
NC_021823_4
NC_021826_3
NC_021838_3
NZ_CM003382_2
NZ_CP009242_2
NZ_CP013722_1
NZ_HG813249_3
ATTTACATTTCATAATAAGTAGTTAAAAC
29

NC_011660_2
NC_017529_1
NC_017537_1
NC_018590_2
NZ_CP009242_1
NZ_CP013286_1
NZ_CP013287_2
ATTTACATTTCACATTAAGTAACTAAAAC
29

NC_011661_1
NC_011661_2
GTTTCAATCCCTTATAGGTACGCTACAAAC
30

NC_011662_10
GGTTCCCCCGCGTCCGCGGGGATAGGCCC
29

NC_011726_1
NC_013161_1
GTTTCAATCCCATTACTAGGATTCATTAAAAAGAAAC
37

NC_011726_10
NC_013161_9
GTTTCAATCCCATTGCTAGGATTCATTAATAAGAAAC
37

NC_011726_11
TTTTATTAAGAGAAATTAGTTGAATGGAAAC
31

NC_011726_4
NC_013161_4
GTTTCTTATTAATGAATCCTAGTAATGGGATTGAAAC
37

NC_011726_8
AGTTTCATCAACCCTCCTGATGTGGGATGGGTTGAAAG
38

NC_011726_9
GTTTCATACAGGTTTTTGACCTCCCATTGATTGAAAG
37

NC_011729_11
CTTTCTATTTAATGAATCCTGGTAACGGGATTGAAAC
37

NC_011729_12
GTTTCAACAGCCCTCCCGATGTGGGATGGGTTGAAAG
37

NC_011729_14
NC_011729_35
GTTTCCAACAATTCCTATTCAACCCAATAGGTAGGG
36

NC_011729_17
GTGAGTAACGCCTTACGACATCAAGCTATAAATCAC
36

NC_011729_19
GTATTCCCCATGCTTGTGGGGGTGAACCG
29

NC_011729_20
GTTTCAATCCCGTTGCCAGGATTCATTAAATAGAAAG
37

NC_011729_26
GTTACAATTAAAATGAATCCCTATTAGGGATTGAAAC
37

NC_011729_32
NC_011729_7
GTTTCCAACAAGTCCTATTCAACCCAATAGGTAGGG
36

NC_011729_40
GTTTCAATCCCGTTGCCAGGATTCATTAATTAAAAAG
37

NC_011729_6
GTTTCCAACAATTCCTATTCTACCCAATAGGTAGGG
36

NC_011737_1
GTGATCAACGCCTTTCGGCATCAAAGGTTAAAGTAG
36

NC_011738_1
CCCTACCTATTGGGTTAAATAGGAATAGTTGGAAACGA
38

NC_011740_3
NZ_CM001142_4
GAGTTCACTGCCGTACAGGCAGCTTAGAAA
30

NC_011761_1
NC_011761_2
CTTCTCAGCCGCGCGTGTGGCGGCATACCGC
31

NC_011761_3
GTATGCCGCCAGGTGCGCGGCTGAGAAC
28

NC_011761_4
GTATGCCGCCATATGCGCAGCTTGTAAT
28

NC_011766_1
NC_018001_1
GAATACAATAGAAAGAATTGAAAG
24

NC_011766_2
GAAGCAATAATGAAGAATTGAAAG
24

NC_011768_3
GTCTTCCCCACGCCCGTGGGGGTGTTTCT
29

NC_011769_3
GTCGCCCCTCACGCGGGGGCGTGGATAGAAAC
32

NC_011770_1
NC_023066_1
NZ_CP006980_1
NZ_CP006981_1
NZ_CP006982_1
NZ_CP006983_1
NZ_CP006984_1
NZ_CP006985_1
NZ_CP007399_3
NZ_CP008856_1
NZ_CP008856_3
NZ_CP008856_6
NZ_CP008872_1
GTTCACTGCCGTACAGGCAGCTAAGAAA
28

NC_011830_1
GTCACTCCTCGTATGAGGAGTGTGGATTGAAAT
33

NC_011830_2
GTCGAGGCCTCTACGAGGCTCGAGGGTTGAAAT
33

NC_011830_4
GTTTCAATCCCTTATAGGTAAGCTAACAAC
30

NC_011830_6
GTTTCAATTCCTCATAGGTAAGCTAACAAC
30

NC_011831_2
NC_011831_3
GTTTCAGTGCTCTACCGTGAGCCGAAAGTATTGAAAG
37

NC_011831_36
CTTCAAAACACCAAAATCCCCGTGAGGGGATTGAAAC
37

NC_011832_4
NC_011832_5
CGGTTCATCCCCACGCTTGTGGGGAACTC
29

NC_011835_4
NC_012814_4
NC_012815_4
NC_017214_1
NC_017215_4
NC_017216_4
NC_017217_4
NC_017866_4
NC_017867_4
NC_021593_4
NZ_CP007522_4
NZ_CP007755_4
NZ_CP009045_4
NZ_CP010433_4
CCCTCAATGAAGCTCCGAAGCCGAGACTTCGGAGAT
36

NC_011880_1
NC_011880_2
NC_011880_3
GTCCCTACTTGTTAGGGAAATCAATTGAATGGAAAC
36

NC_011883_1
TGGAGCGGGAAACGGGATTTGAACCCGC
28

NC_011883_2
GTGTTCCCCACGGGCGTGGGGATGAACCG
29

NC_011884_10
CGGCTCACCCCCACAGGTATGGGGACAAC
29

NC_011884_8
GTTTCCAAGCCTGAATCCCGGTCTACGGGACTGAAAC
37

NC_011886_3
GGTTTCGACGGGCTCAACCACCG
23

NC_011894_1
GTGCCAACGCGCTCAGGATCTGGCGCCCACTGCGAC
36

NC_011894_10
CGGATCATCCCCGCATCCGCGGGGGACAC
29

NC_011894_11
GTTTCAATCCGCGCCCCCGTGAGAGGGCGAC
31

NC_011894_3
GTTTCAATCCGCGCCCCCGTGAGGGGGCGAC
31

NC_011898_1
NC_011898_2
NC_016791_1
GTCGCTCCTCTCGTAGGAGCGTGGATTGAAAT
32

NC_011898_3
GTTATAGCTCCAATTCAGGCTCCGATATGCTATAAT
36

NC_011899_1
GTTTCAATCCTTCTTATGCTGGATGTATCAATTAATC
37

NC_011901_10
CGTAGGTCGGCCTTCAGGCCGACA
24

NC_011901_5
GTCCCTACCCGGGAAGCCGTTAAGGCTGTTGAAACC
36

NC_011901_8
GCTTCAATGAGGCCGCGGCTAAATGCCGCGGATGAC
36

NC_011959_1
GTTTCGACAGTACCTATGAGGGCTTGAAAC
30

NC_011963_3
GTCGCCCCTCACGCGGGGGCGTGGATCGAAAC
32

NC_011978_1
NC_011978_3
NC_011978_8
NZ_CP007633_5
NZ_CP007633_8
GTTTCCATACCTCAAAGGAAGTATTGAAAC
30

NC_011978_6
CGGGTTTCAATACTTCCTTAGAGGTATGGAAAC
33

NC_011979_2
GTTTCAATCCTCGCCCGCCTTTACAGACGGGCGCTAC
37

NC_011992_1
GTTGTAGCTCCCTCTCTCACCCCGGATAGCTACACT
36

NC_012029_5
TCGCCGTTCTCCTCTTCGCCGTTCTC
26

NC_012030_1
GCTTCAAACCCACGAGGGGTTCGGCTGAAAG
31

NC_012030_2
NC_012030_3
ACTACCCCACTATTTCCGCTGTTAG
25

NC_012030_4
GTCGAGACACTCAGAAAACCCAGCACGGGATTGAAAC
37

NC_012032_9
GGCCCAACTGGCGCAGGCGCAGGC
24

NC_012034_1
NC_012034_2
NC_014392_1
NC_014392_2
NC_014392_3
NC_014652_5
NC_014657_1
NC_014720_1
GTTTTATCTGAACTATGAGGGATGTAAAC
29

NC_012034_3
GTTTTTAGCCTCCCCTTTGGGGATTGAAAC
30

NC_012034_5
NC_012034_7
NC_014392_10
NC_014392_5
NC_014392_6
NC_014392_7
NC_014392_8
NC_014392_9
NC_014652_4
NC_014720_2
NC_014720_3
NC_014720_4
NC_014720_5
NC_014721_1
NC_014721_10
NC_014721_11
NC_014721_2
NC_014721_4
NC_014721_6
NC_014721_8
NC_015949_8
NC_015949_9
GTTTGTAGCCTCCCCTTTGGGGATTGAAAC
30

NC_012034_6
TTGTAGCCTGCCCTTTGGGGATTGAAAT
28

NC_012034_8
ATTTGTAGCCTCCCCTTTGGGGATTGAAAC
30

NC_012034_9
GATTTGTAGCCTCCCCTTTGGGGATTGAAAC
31

NC_012108_1
CCTGGAATGCCTGATCCACGACAACAAGGATTGAAAC
37

NC_012214_2
NC_013961_4
NC_013971_1
NC_017390_2
NC_017445_6
NZ_CBVS010000007_3
NZ_CBVT010000007_3
NZ_CBVU010000007_3
GTGTTCCCCGCGTGAGCGGGGATAAACCG
29

NC_012214_3
NC_013961_3
NC_013971_2
NC_017390_3
NC_017445_4
NC_017445_5
NZ_CBVS010000007_2
NZ_CBVT010000007_2
NZ_CBVU010000007_2
GTGTTCCCCGCGTATGCGGGGATAAACCG
29

NC_012214_6
NC_017390_6
TTCACTGCCGTACAGGCAGCTTAGAAAA
28

NC_012438_1
NC_012438_10
NC_012438_2
NC_012438_9
GTTTTCTCCCGACTATGAGGGAATTGAAG
29

NC_012438_11
GTTTTTCTCCCGACTATGAGGGAATTGAAG
30

NC_012438_12
NC_012438_7
NC_012438_8
GTTTTTTCCCGACTATGAGGGAATTGAAG
29

NC_012438_13
NC_012438_6
GTTTTTCTCCCGACTATGAGGGAATTGAAAC
31

NC_012438_3
GTTTTGTCTGAACTATGTGGGATAGAAAG
29

NC_012438_4
CTTTATATCCCACATAGTTCAGACAAAAC
29

NC_012438_5
NC_013939_2
NC_013939_3
GTTTCAATTCCTCATAGGCACTCTAAAAAC
30

NC_012440_1
GTTGAAGTTTTCCCGAGATATAAGGGAATTGCGAC
35

NC_012440_2
CTTTCTATCCCACTTAGTTCAAAGAAAAC
29

NC_012440_3
GTTTTTTCTGAACCAAGTGGGGTATAAA
28

NC_012440_4
GTTTTCTTTGAACCAAGTGGGATAGAAAG
29

NC_012440_5
GTTTCTTTGAACTAAGCGGGATAGAAAG
28

NC_012470_3
ATTTCAATCCACTCGCCCGCAAAGGGCGAGAC
32

NC_012483_1
NZ_CP014754_5
GTTTCAATCCACGCGCCCGCGAGGGGCGCGAC
32

NC_012560_2
NC_012560_3
NC_021149_2
NC_021149_3
NC_021150_2
NC_021150_3
GTTTCAATCCACACGCCCGCATGGGGCGTGAC
32

NC_012563_7
ATTTAAATACATCATATGTTACTGTTCAAC
30

NC_012563_8
NC_017299_4
NZ_AP014696_5
ATTTAAATACATCTCATGTTAATGTTCAAT
30

NC_012588_1
NC_012632_1
NZ_AHJO01000001_1
NZ_AHJT01000001_1
GATTAATCCTAAAAGGAATTGAAAG
25

NC_012589_1
GATAAATCCCCAAAGGGATTGAGAG
25

NC_012589_2
CTTTCAATCCCTTTTGGGATTTATC
25

NC_012589_3
NC_012589_4
NC_013769_2
NC_013769_3
CTTTCAATTCTATAGTAGATTAAC
24

NC_012590_1
NZ_CP010827_2
GTGCTCCCCGCGTAAGCGGGGATGAGCC
28

NC_012623_1
NC_017276_8
NZ_CP011055_1
NZ_CP011056_1
TGGCTACTAAGCAAGATATTGAAAGACTAGA
31

NC_012654_1
TGTTTCACTTTTATCGTGCACTTTT
25

NC_012658_1
NC_012658_2
NZ_CP006908_4
NZ_CP006908_5
NZ_CP006908_6
ATTTAAATACATCTTATGTTAATGTTCAA
29

NC_012658_6
ATTTAAATACATCTCATGTTATTGTTCAACAA
32

NC_012691_2
CTTCACTGCCGCACAGGCAGCTTAGAAA
28

NZ_CP009435_1
TTTCTAAGCTGCCTACACGGCAG
23

NC_012731_4
NC_012912_4
NC_018522_2
NZ_CM001841_7
NZ_CM001841_8
NZ_CM001981_6
NZ_CM001981_7
NZ_CP006798_1
NZ_CP012043_2
NZ_CP012753_2
NZ_CP013711_3
NZ_CP014004_2
NZ_CP014008_2
NZ_CP014010_4
NZ_CP016814_4
NZ_CP016923_3
GAAACACCCCCACGTGCGTGGGGAAGAC
28

NC_012731_5
NZ_CP006798_2
NZ_CP008929_3
NZ_CP012043_3
NZ_CP012753_1
NZ_CP014004_1
NZ_CP015990_2
NZ_CP016923_2
NZ_CP016926_2
NZ_CP017385_3
AGAAACACCCCCACGCGTGTGGGGAAGAC
29

NC_012778_1
ATCTACAAAGTAGAAATTATTTAAGGTTATTCAAAC
36

NC_012781_2
ATTTTAGTAACTGAATAATTTACGTGACTGTAAAAC
36

NC_012781_3
NC_021010_5
NC_021044_1
ATTTCAATCCACGCTCCCACGAGAGGAGCGAC
32

NC_012785_1
NC_012785_2
GTTTCCATACCACATTGGTTCTTTCCAAAC
30

NC_012785_3
GTTTGGTAAGAACCAATGTGGTATGGAAAC
30

NC_012785_4
NC_012785_5
GTTTATAGAATACCTATGAGGAATTGAAAC
30

NC_012793_1
NC_012793_3
NC_012794_1
NC_015660_6
NZ_CP008904_1
NZ_CP008904_2
NZ_CP012712_9
NZ_CP014336_1
NZ_CP014336_2
NZ_CP016622_9
GTTTTTATCTTACCTATGAGGAATTGAAAC
30

NC_012793_2
GTTTGTATCTTAACTATGAGGAATTGAAAC
30

NC_012793_4
GTTTTTATCTTACCTATGAGGAATTGAAA
29

NC_012796_1
GTCGCCCCCTGCGCGGGGGCGTGGATTGAAAC
32

NC_012796_3
TTTTCTGAGCTGCCTATGCGGCAGTGAAC
29

NC_012804_1
NC_012804_2
NC_012804_3
NC_015865_3
NC_015865_4
NZ_CP007140_1
NZ_CP007140_2
NZ_CP007264_1
NZ_CP008887_1
NZ_CP008887_2
NZ_CP008887_3
NZ_CP015520_1
CTTTCAATTCTCCTAGAGTCTTATTGCAAC
30

NC_017866_1
NC_017867_1
NZ_CP007522_1
NZ_CP007755_1
NZ_CP009045_1
NZ_CP010433_1
GGTCGGTTTTGCGGATGCTTCCG
23

NC_012880_1
NZ_CM001976_8
NZ_CM001979_6
NZ_CM001982_4
NZ_CM001982_5
TTTCTAAGCTGCCTACGCGGCAGTGAAC
28

NC_012880_2
NC_014500_3
NC_014500_4
NZ_AOOB01000046_1
NZ_CM001838_10
NZ_CM001838_11
NZ_CM001840_4
NZ_CM001841_10
NZ_CM001841_11
NZ_CM001857_2
NZ_CM001857_3
NZ_CM001858_4
NZ_CM001858_5
NZ_CM001858_6
NZ_CM001904_2
NZ_CM001974_1
NZ_CM001974_2
NZ_CM001975_7
NZ_CM001975_8
NZ_CM001976_10
NZ_CM001976_9
NZ_CM001978_7
NZ_CM001979_7
NZ_CM001980_5
NZ_CM001980_6
NZ_CM001982_6
NZ_CM001982_7
NZ_CM001984_7
NZ_CM001985_5
NZ_CM002023_4
NZ_CM002023_5
NZ_CP009460_4
GTTCACTGCCGAGTAGGCAGCTTAGAAA
28

NC_012880_3
NZ_CM001857_4
CGGTTTATCCCCACGGGTGTGGGGAACAC
29

NC_012883_1
NC_022084_2
NC_022084_3
NC_022084_4
NC_022084_5
NC_022084_6
NC_022084_7
GTTCCAATAAGACTTTAAAAGAATTGAAAG
30

NC_012891_2
NC_017567_2
NC_018712_2
NC_019042_1
NC_019042_2
GTTTTGGGACCATTCAAAACAACATAGCTCTAAAAC
36

NC_012912_2
NC_014500_2
NZ_CM001839_1
NZ_CM001842_1
NZ_CM001859_2
NZ_CM001860_6
NZ_CM001979_5
NZ_CM001981_3
NZ_CM001981_4
NZ_CM001984_5
NZ_CM001984_6
NZ_CP009460_5
NZ_CP009460_6
NZ_CP015137_1
GTTCACTGCCGTGTAGGCAGCTTAGAAA
28

NC_012912_3
NZ_CM001904_3
NZ_CM001974_3
NZ_CM001981_5
TTTCTAAGCTGCCTATACGGCAGTGCAC
28

NC_012913_1
NZ_CP009230_1
GCAGCCGCCTCCGCGCGGCTGTGTGTTGAAAC
32

NC_012917_4
TGTCCTTACGGACGCTCCCTGACT
24

NC_012917_5
GTCCTTACGGACGCTCCCTGACTGAAGGGATTAAGACT
38

NC_012962_2
GTTCACTGTCGTACAGGCAGCTTAGAAAA
29

NC_012962_7
TTTCTAAACTGCCTGTACGGCAGT
24

NC_012962_9
TTTCTAAGCTGCCTGTACGGCAGTACAC
28

NC_012997_2
GTTTCAATCCACGCGCTCGCGAGGAGCGCGAA
32

NC_012997_5
GTTTCAACAGCCTTAGCGGCTAGACCTCCAGCGACGC
37

NC_013016_1
NC_013016_2
GGTTGTAGCTCCCTTTCTCATTTCGCAGTGCTACAAT
37

NC_013016_4
NC_013016_5
NC_017517_4
NC_017517_5
CCGGATTCCCGCCTGCGCGGGAATGACG
28

NC_013124_2
NC_013124_3
GGATCACCCCCGCCTGCGCGGGGAGCAC
28

NC_013131_12
NC_013131_17
GGGATCAGCCCCGCGCCTGCGGGGAGCAC
29

NC_013131_13
NC_013131_14
NC_013131_15
GGGACCAGCCCCGCACGCGCGGGGAG
26

NC_013131_16
ATCAGCCCCGCGCCTGCCGGGAGCAC
26

NC_013156_1
CTTTCCATTCCGTTCCGGTCTGATTTTAAC
30

NC_013156_2
GTTAAAATCAGACCGGAACGGTATGGAAAG
30

NC_013156_3
GTTTCCATACCGAGACGGTCTGATTTTAAC
30

NC_013156_4
AATTTCCATTCCGAAACGGTCTGATTTTAAC
31

NC_013156_5
NC_013156_6
ATTTCCATACCGTTCCGGTCTGATTTTAAC
30

NC_013156_7
GTTAAAATAAGACCGTCTCGGTATCTAATA
30

NC_013156_8
GTTAAAATCAGACCGTCTCGGTATGGAAAT
30

NC_013158_1
NC_021921_3
GCTTCAACCCCACGAGGGTCCGTCTGAAAC
30

NC_013159_1
GTCCGCCCCGCGCGTGCGGGGATGAACC
28

NC_013159_10
GTCGGCCCCGCGCACGCGGGGATGGACC
28

NC_013159_2
NC_013159_3
GTCTGCCCCGCGCATGCGGGGATGAACC
28

NC_013159_4
NC_013159_5
NZ_CM001484_2
NZ_CM001484_3
CGGACCACCTCCACGTGCGTGGAGAGCAC
29

NC_013159_6
NC_013159_7
NZ_CM001484_8
GGACCATCCCCGCGTGCGCGGGGCCGAC
28

NC_013159_8
NZ_CM001484_7
GTCGGCCCCGCGCACGCGGGGATAGTCC
28

NC_013159_9
NZ_CM001484_5
NZ_CM001484_9
GTCGGCCCCGCACACGCGGGGATAGACC
28

NC_013160_1
GTTTCAATCCCTCATAGGGATTAACAATAATTGGAAC
37

NC_013161_5
NC_013161_7
GTTTCAACGACCATTCCCAACAGGGATGGGTTGAAAG
37

NC_013161_6
CTTTCAACCTACCCCTTATCGGGATGGCGGTTGAAAC
37

NC_013161_8
TCCTAATTTAACCCAATAGGTAGGGA
26

NC_013162_2
GTTGTGAATTGCTTTCAAATTTTGTAGTTTTGCGATTGATAACA
44

NC_013192_2
GTTTTAATAGCACAAATTGTATTGTAAAT
29

NC_013192_4
GTTTCAATCCTTGTTTTAATGGATAACTTACTTTAAC
37

NC_013192_6
GTTTCAATCCTTGTTTTAATGGATACTCTACTTTAAC
37

NC_013192_8
AGTTAAAGTAGAGTATCCATTAAAACAAGGATTGAAAC
38

NC_013194_1
GTCTCAATCCCTTTGATTTCAGGGCTGGTTACTGAC
36

NC_013194_2
GTTTCCCCCGCGTCAGCGGGGATAGGCCC
29

NC_013198_2
NC_017482_2
GCTCTTGAACTGATTGATCTGACATCTACCTGAGAC
36

NC_013201_1
NC_013202_12
GCTTCAATCCCACAAGGGTCCGTCTGAAAC
30

NC_013204_1
ATTTCAACCCGCACTCCCCATGCGGGGAGTGAC
33

NC_013204_2
ATCCACGCGCCCTGCATGAGGGTGCGAC
28

NC_013205_1
CTTAATCCGCCGAGATCGTCGGCGGCCCCATTGAAGC
37

NC_013205_2
GCTTCAATGGGGCCGCCGACGATCTCGGCGGATTAAC
37

NC_013205_3
NC_017167_4
GTTGTTCCGCCGAGATCGTCGGCGGCCCCATTGAAGC
37

NC_013205_4
NC_017167_5
GTTGATCCGCCGAGATCGTCGGCGGCCCCATTGAAGG
37

NC_013210_1
NC_016027_2
NC_017101_1
NC_017104_1
NC_017117_1
NC_017130_1
NC_017134_1
NC_017136_1
NC_017143_1
NZ_CM000920_2
NZ_CP016328_1
GTGTTCCCCGCACACGCGGGGATGAACCG
29

NC_013216_1
NC_013216_2
GATCTAATTTAGCCATAGTGGAATGTAAAT
30

NC_013216_10
ATTTCAATCCACGCCCCCGTGTAGGGAGCGAC
32

NC_013216_12
ATTTCAATTCCTCATAGATAGGCTAAAAAC
30

NC_013216_3
NC_013216_4
GTTTTTAGCCTACCTATAAGGAATTGAAAT
30

NC_013216_5
GTTTTTAGCCTACCTATGAGGGATTGAAAT
30

NC_013216_6
AGTTTCAATTCCCTATGGGAATTATTTTGTTTTCAGAC
38

NC_013216_7
GTTTCAATTCCCTACGGGAATTATTTTGTTTTCAGAT
37

NC_013216_8
ATTTCAATACATCAAATGTGACGGTTTCCC
30

NC_013216_9
GTTTTTAGTCTACCTATGAGGAATTGAAAC
30

NC_013223_2
GCTTCAATGGGGCCACACTTTGCAGTGTGGTTGAGAC
37

NC_013235_10
NC_013235_11
NC_013235_8
NC_013235_9
GGGCTCATCCCCGCGGGCGCGGGGAGCAC
29

NC_013235_2
GTTGCATTCCACGTCACGCCGTTGGGCGTATAGAAAC
37

NC_013235_3
NC_013235_4
GTCAGAAACCACGTCACGCCGTCAGGCGTATAGAAAC
37

NC_013260_3
CCTTCAATGGGGCCACGGCTCTGAGGCCGTGGAAAC
36

NC_013315_14
NC_013316_14
NC_017178_14
NC_017179_14
NZ_CM000441_13
NZ_CM000657_13
NZ_CM000658_13
NZ_CM000659_12
NZ_CM000661_13
GTTTTATATTAACTATATGGAATGTAAATC
30

NC_013315_16
NC_013316_16
NC_017178_16
NC_017179_16
NZ_CM000441_15
NZ_CM000657_15
NZ_CM000658_15
NZ_CM000659_14
NZ_CM000661_15
CTTTACATTCCATATAGTTAATATAAAAC
29

NC_013315_20
NC_013316_20
NC_017178_20
NC_017179_20
NZ_CM000441_19
NZ_CM000657_19
NZ_CM000658_19
NZ_CM000659_18
NZ_CM000661_19
ATTTATAACTAACTTAGTGTAATTTAAAC
29

NC_013315_3
NC_013315_4
NC_013315_6
NC_013315_9
NC_013316_3
NC_013316_4
NC_013316_6
NC_013316_9
NC_017178_3
NC_017178_4
NC_017178_5
NC_017178_6
NC_017178_7
NC_017178_8
NC_017178_9
NC_017179_3
NC_017179_4
NC_017179_5
NC_017179_6
NC_017179_7
NC_017179_8
NC_017179_9
NZ_CM000441_2
NZ_CM000441_3
NZ_CM000441_4
NZ_CM000441_5
NZ_CM000441_6
NZ_CM000441_7
NZ_CM000441_8
NZ_CM000657_2
NZ_CM000657_3
NZ_CM000657_4
NZ_CM000657_5
NZ_CM000657_6
NZ_CM000657_7
NZ_CM000657_8
NZ_CM000658_2
NZ_CM000658_3
NZ_CM000658_4
NZ_CM000658_5
NZ_CM000658_6
NZ_CM000658_7
NZ_CM000658_8
NZ_CM000659_2
NZ_CM000659_3
NZ_CM000659_4
NZ_CM000659_5
NZ_CM000659_6
NZ_CM000659_7
NZ_CM000661_2
NZ_CM000661_3
NZ_CM000661_4
NZ_CM000661_5
NZ_CM000661_6
NZ_CM000661_7
NZ_CM000661_8
TTGAATGGTAAAAAATATTACTTT
24

NC_013357_1
NC_015715_1
NZ_CM004386_1
GTCGCCTCCTTCGCGGAGGCGTGGATTGAAAC
32

NC_013385_10
CTTTCAGTCCCCTTGTCATCGGGGAAGGTACTGCAAC
37

NC_013385_2
NC_013385_4
NC_013385_5
NC_013385_6
NC_013385_7
GTTTGTAGCCTACCTATGAGGGATTGAAAC
30

NC_013385_3
GTTTGTAGCCTACCTATGAGGGCTTGAAAC
30

NC_013385_8
ATTTGTAGCCTACCTACGAGGGGTTGAAAC
30

NC_013407_1
NC_013407_10
NC_013407_12
NC_013407_16
NC_013407_17
NC_013407_2
NC_013407_20
NC_013407_4
NC_013407_6
NC_013407_8
NC_013407_9
ATTAAAATCAGCACGGATCGTGATGGAAAC
30

NC_013407_11
ATCACGACCCGTGCTGATTTTAAT
24

NC_013407_13
AATTAAAATCAGCACGGATCGTGATGGAAAC
31

NC_013407_14
ATTTCCATCACGATCCGTGCTGATTTTAAT
30

NC_013407_15
NC_013407_18
NC_013407_5
TTTCCATCCTCGAAGAGGTCTGATTTTAAT
30

NC_013407_21
GTTTCCATCACGACTCGTGCTGATTTTAAT
30

NC_013407_3
ATTAAAATCAGCACGGATCGTGATGGAAACT
31

NC_013407_7
GTTTCCATCACGACCCGTGCTGATTTTAAT
30

NC_013410_1
NC_017448_1
GTTGTTATTGCACTAGTAAAACTAGAAAATCTGAAAGCAATTCACAAC
48

NC_013410_10
NC_013410_11
NC_013410_12
NC_013410_13
NC_013410_14
NC_013410_8
NC_013410_9
NC_017448_10
NC_017448_11
NC_017448_12
NC_017448_13
NC_017448_14
NC_017448_8
NC_017448_9
CCCTGAAAAGCATTCCTCTCGCAAGAGAGATTAAGAC
37

NC_013410_2
NC_013410_3
NC_013410_4
NC_017448_2
NC_017448_3
NC_017448_4
CCCTGAAAAGCATTACTCTCGCAAGAGAGAT
31

NC_013410_5
NC_013410_6
NC_013410_7
NC_017448_5
NC_017448_6
NC_017448_7
CCCTGAAAAGCATTACTCTCGCAAGAGAGATT
32

NC_013421_4
NC_013421_5
NC_017731_4
NC_017731_7
NC_018525_6
NZ_CM001772_2
NZ_CM001976_7
NZ_CM001982_3
NZ_CP008920_2
NZ_CP008920_3
NZ_CP008920_4
NZ_CP008920_6
NZ_CP009261_1
NZ_CP014024_3
NZ_CP014024_4
NZ_CP014024_5
NZ_CP015613_2
NZ_CP015749_1
NZ_CP015749_2
GTTCACTGCCGTATAGGCAGCTTAGAAA
28

NC_013422_1
GTTTCAATCCGCGCCCGGCGGTTAGGCCGGGCGATTC
37

NC_013440_10
NC_013440_11
NC_013440_12
GTTTCCACGACCCAACAGTCGTGGCCTCATTGAAGC
36

NC_013501_1
GGTGTCCCCGCACCCGCGGGGATAGTCCC
29

NC_013501_5
NC_013501_6
NC_015966_4
NC_015966_5
NC_015966_6
ATTTCAATACCAAAAAGGTGCGATTAAAAC
30

NC_013502_1
NC_013502_2
NC_013502_3
NC_013502_4
NC_013502_5
NC_015970_3
NC_015970_4
NC_015970_5
NC_015970_6
NC_015970_7
NC_015970_8
GTCGTAATCCCCTTTTCATCGGGTCAAGTCTTCGGAC
37

NC_013502_6
NC_013502_7
CCTTCAATGCTGCCGTAGCTATTTAGCTACGGAAAT
36

NC_013510_1
GTTGCGATCCCTCTGAGGGGTGATGAGGACC
31

NC_013510_10
NC_013510_11
NC_013510_9
GTGCTCCCCGCGCAGGCGGGGGTGATCCG
29

NC_013510_14
NC_013510_18
NC_013510_2
GTCCTCATCACCCCTCAGAGGGATCGCAAC
30

NC_013510_15
GGGATCATCCCCGCGTGCGCGGGGAGCAG
29

NC_013510_16
NC_013510_4
CTGCTCCCCGCGCACGCGGGGATGGTCCC
29

NC_013510_3
GGTTGCGATCCCTCTGAGGGGTGATGAGGGC
31

NC_013510_5
GTCCTCATCACCCCTCGGAGGGATCGCAAC
30

NC_013510_8
CGGACCACCCCCGCCTGCGCGGGGAGCAC
29

NC_013512_1
NC_018002_1
NZ_AP014724_5
NZ_AP014724_6
CTCGAACCGACACAAGATTTGTATTTAAAC
30

NC_013515_1
CATTCACATTATTCAAATTTACCAAGAATCTGTATC
36

NC_013517_2
CTATTAATATAACTATCCTAGAATGTAAATT
31

NC_013517_3
CTATTAATATAACTATCTTAGAATGTAAATT
31

NC_013517_4
NC_013517_5
GTATTAATATAACTATCTTAGAATGTAAAT
30

NC_013520_1
GTTTCCGTCCCCTAATGGGGATTATTTAATTTAAC
35

NC_013520_10
GTTTCCGTCCCCTAATGGGGATCATTTAATTTAAC
35

NC_013520_2
NC_013520_4
GTTTCAATACCGTAAACGGTAAGTGCTGTTGCAAC
35

NC_013520_3
NC_013520_6
NC_013520_8
GTTTCAATACCGTAAACGGTAGGTACTGTTTCAAC
35

NC_013520_5
GTTTCAATACCGTAAACGGTAAGAGCGGTTGCAAC
35

NC_013520_7
GTTTCAATACCGTAAACGGTAAGTACTGTTGCAAC
35

NC_013520_9
GTTTCAATACCGTAAACGGTAAGCACTGTTGCAAC
35

NC_013524_5
CGGTTCACCCCCACGCGTGTGGGGACAAC
29

NC_013525_1
NC_013525_3
NC_013525_5
ATTGTCCCCACACGCGTGGGGGTGAACCG
29

NC_013526_1
ATCGTCCCCACACGCGTGGGGGTGAACCG
29

NC_013526_3
GTTTCAATCCCTTATAGGTAGGCTACGAAC
30

NC_013530_1
GGGGTGGTTTCGACAGGCTCAACCACCG
28

NC_013530_11
NC_013530_16
CGGTGGTTGAGCCTGTCGAAACCACCCCA
29

NC_013530_15
NC_013530_2
CCGGTGGTTGAGCCTGTCGAAACCACCCCAC
31

NC_013530_3
GGTTGAGCCTGTCGAAACCACCC
23

NC_013530_6
CCGGTGGTTGAGCTTGTCGAAACCACC
27

NC_013530_9
GGGCTCACCCCCGCCTACGCGGGGAGCAC
29

NC_013654_2
NC_017644_3
NC_022648_2
NZ_CP010876_2
NZ_CP013658_2
NZ_CP013831_2
NZ_CP013835_2
NZ_CP014316_2
NZ_CP014488_2
NZ_CP014492_2
NZ_CP014495_2
NZ_CP014497_2
NZ_CP014522_2
NZ_CP015069_2
NZ_CP015076_2
NZ_CP015159_2
NZ_HG941718_2
AGTTCACTGCCGTACAGGCAGCT
23

NC_013714_11
NZ_AP012326_11
NZ_CP007456_4
ATTTCAATCCACGCTCTCCGTGAGGAGAGCGAC
33

NC_013714_9
NZ_AP012326_9
ACTGGGAATTAGCTTCTACCCTTCTTGATAAACTTG
36

NC_013715_6
GCCTCAATGAAAGTCCCCGCCCGAAGGCGGGGAAAT
36

NC_013715_7
CCCTCAATGAAAGTCCCTCCGAAAAGGAAGGGAAAT
36

NC_013716_11
TAAGTTCCCCGCGCGAGCGGGGATAGACCGT
31

NC_013716_3
ATGCCGGAATCAGAATCCGGTGC
23

NC_013720_2
NC_013720_3
GTGTGAGAAAGAGGCCCTTCGGGGCCGATTGAGAC
35

NC_013721_3
GTCTTTCCCGCATACGCGGGGGTGATCC
28

NC_013722_1
NC_013722_6
NZ_CP009747_1
NZ_CP009747_2
NZ_CP009747_3
NZ_HG916826_5
NZ_LK391695_5
TTTCTGAGCTGCCTACACGGCAGTGAAC
28

NC_013722_2
NC_013722_3
TTCACTGCCGTGTAGGCAGCTCAGAAA
27

NC_013722_5
NC_015556_1
NZ_CP010892_2
NZ_CP010892_6
NZ_CP011110_1
NZ_CP011110_5
NZ_CP014135_3
TTTCTGAGCTGCCTATACGGCAGTGAAC
28

NC_013730_3
ATTCCCGAGGCTGATCCATTAGAAGAAGGATTGAAAC
37

NC_013740_4
GTCGCCCCCGCAAGGGGGCGTGGATTGAAAT
31

NC_013766_2
NC_013768_2
NC_017547_1
NC_018592_2
NC_018593_1
NC_021837_1
NZ_CP006858_2
NZ_CP006859_2
NZ_CP006860_2
NZ_CP006861_2
NZ_CP006862_2
NZ_CP007160_4
NZ_CP007689_2
NZ_CP009258_1
NZ_CP011345_3
NZ_CP013722_2
NZ_CP013724_3
NZ_CP013919_2
NZ_HG813247_2
TTTTAGTTACTTATTGTGAAATGTAAAT
28

NC_013769_4
GTTTTAGTTTCTTTTCGTTATTAC
24

NC_013790_17
ATTTCAATCCCAAAATGGTCTGATTTTAAC
30

NC_013790_23
GTCGCAATCCTTGTTTTAGTAGATTAGCTTTTGCAAT
37

NC_013790_24
GTCACAATCCTTGTTTTAGTAGATTACTTTTTGCAAT
37

NC_013798_1
NC_015600_1
NC_016749_1
NZ_CP013688_3
NZ_CP013689_1
GTTTTACGGTTACTTAAATCTTGAGAGTACAAAAAC
36

NC_013799_1
NC_017161_1
GTTTCAATCCCTTATAGGCACCTAATAAAC
30

NC_013849_1
NC_013849_4
NC_013849_6
NC_013849_7
NC_013849_8
CTTTCAATCCTCTTTTCATCGAG
23

NC_013849_5
GTTTCAGTCCTCTATTTGAGATTC
24

NC_013850_2
ATGTTCCCCGCGCCAGCGGGGATAAACCG
29

NC_013850_3
NZ_CP009208_1
NZ_CP013711_4
GTCTTCCCCACATGCGTGGGGGTGTTTC
28

NC_013851_3
CGGTTCATCCCCGCGAGCGCGGGGAACGG
29

NC_013852_1
GTTCGGCACTGAGACCCGAATTGAGGGGATTAAGAC
36

NC_013852_2
GTCCGCATTGAGACCCGCTTTCGAGGGGATTAAGAC
36

NC_013854_10
NC_013854_9
GCTTCAATGAGGCCTGGGCGTTTCCGCCCAGGAAGGG
37

NC_013854_2
GTTGCGGCTGGACCCCCGATCCCCATCGGCTACACT
36

NC_013854_3
GTTCAACGCTGTTCCGCTTTGGGAAGCGGATTGAAAC
37

NC_013854_4
GTTCGGAGGCGTTCCGCTATGGGAAGCGGATTGGAAC
37

NC_013854_7
NC_013854_8
GCTTCAATGAGGCCCAAGCATTTCTGCCTGGGAAGAC
37

NC_013887_1
GTTTCCATCCTCCAAGAGGTCTGATTTTAACA
32

NC_013887_10
NC_013887_14
NC_013887_15
NC_013887_16
NC_013887_17
NC_013887_18
NC_013887_19
NC_013887_20
NC_013887_3
NC_013887_4
NC_013887_8
GTTTCCATACCGAATCGGTCTTATTTTAAC
30

NC_013887_11
NC_013887_6
NZ_CP009149_8
GTTAAAATCAGACCGATTCGGTATGGAAAC
30

NC_013887_12
NC_013887_24
GTTAAAATAAGACCTCTTGGAGGATGGAAAC
31

NC_013887_13
NC_013887_2
NC_013887_9
NC_013888_1
GTTTCCATCCTCCAAGAGGTCTGATTTTAAC
31

NC_013887_21
GTTAAAATCAGACCTCTTAGAGGATGGAAAC
31

NC_013887_23
GTTTCCATCCTTGTTTTAATGGACTAC
27

NC_013887_5
GTTAAAATAAGACCGATTCGGTATGGAAA
29

NC_013889_2
GTTAGCTGCCGCACAGGCAGCTCAGAAA
28

NC_013891_2
NC_013891_4
NC_016011_1
NZ_CM001051_1
NZ_CP007172_1
NZ_CP009577_1
GTTTTAATTACTTATTGTGAAATGTAAAT
29

NC_013891_3
NZ_CP009576_1
GTTTTAACTACTTATTGTGAAATGTAAAT
29

NC_013891_5
GTAAGAGACTACCTCTATATGAAAGAGGACTAAAAC
36

NC_013892_4
NC_013892_5
NC_013892_6
CGGTTTATCCCCGTACCTACGGGGAACAC
29

NC_013893_1
NC_017353_1
AATCAGAGAATACCCCGTATAAAAGGGGACGAGAAC
36

NC_013893_3
NC_017353_3
GCAAGTTGGGGTGGGGCCCCAACAAA
26

NC_013894_1
CAACTCCACACGGTACATTAGAAAC
25

NC_013921_2
CACTATTTTCAGGATAGGTAGGCTAAAAAC
30

NC_013921_4
NC_013921_5
NC_014410_2
NC_014410_3
NC_015520_2
NC_017992_6
NC_019970_1
NC_019970_2
NC_019970_3
GTTTCAATTCCTCATAGGTAGGCTAAAAAC
30

NC_013922_3
GTTCCAGAACTACCCTTGTGGGATTGAAGC
30

NC_013923_2
GTTTCAGACGAACCTTTGTAGGGTTGAAGG
30

NC_013926_1
NC_013926_2
GTTTCCACACCACATGGTACTTCTTCTAC
29

NC_013928_1
ATTTTACCCGCACGAGCGGGGGTGATCCT
29

NC_013930_1
GTGGAAAGCACGTCCCTGTGGGGGCGTGGTTGGAAC
36

NC_013940_1
NC_013940_2
GTTTCAACTCCTGATAGGTACAATATAAAC
30

NC_013941_2
NC_017656_2
NZ_CP015241_1
GCCGGTTTATCCCCGCTGGCGCGGGGAACAC
31

NC_013941_3
NC_017656_3
NZ_CP015241_2
GCGGTTTATCCCCGCTGGCGCGGGGAACTC
30

NC_013946_1
NC_021081_2
GTTGCAAACAAAAAGCCCCGTAAGGGGATTGAAAC
35

NC_013946_3
NC_013946_4
NC_021081_7
NC_021081_8
GTTTCAATCCTCACTCGAGCTATCGCCCGAGTGCAAC
37

NC_013946_5
GCCTCGTCTATCGCTCGAGGCCGGTAGGGCGCGAGC
36

NC_013946_6
NC_021081_5
GTTGCACTCGGGCAAAAGCTCGAGTGAGGATTGAAAC
37

NC_013946_8
NC_021081_3
CGGTTCATCCCCGCGGGTGCGGGGAATAC
29

NC_013947_7
GTTGCGATCCTCGCTGGAGCTGGTGCTCCAGCGCCAC
37

NC_013947_8
GTGGCGCTGGAGCACCAGCTCCAGCGAGGATCGCAACC
38

NC_013947_9
GTGGCGCTGGAGCATCCGCTCCAGCGAGGATCGCAAC
37

NC_013949_1
GTTTTAGCCACTTCATAAATATGTTTATGCTAAAAT
36

NC_013960_2
GTTCGCCGCCGCGTAGGCGGTTTAGAAA
28

NC_013960_3
GCATCACCCGTCCTTCGGGGCGGGTGTGGATTGAAAC
37

NC_013960_4
NC_013960_5
GTTTGAAACGTAGACCTGATAAAGAAGGGATTAAGAC
37

NC_013960_6
NC_013960_7
NZ_CP007031_5
GTTACGAATCCCTATAAGGGGTTATGAG
28

NC_013961_2
NZ_CBVS010000007_1
NZ_CBVT010000007_1
NZ_CBVU010000007_1
TCTAAGCTGCCTGTACGGCAGTGAAC
26

NC_013966_1
GTTTCAGACGAACCCTTGTGGGATTGAAGC
30

NC_013966_2
GGTTTCAGACGAACCCTTGTGGGTTTGAAGC
31

NC_013974_13
NZ_CM000637_5
NZ_CP010888_12
TTTTACATTCCATATAGTTAATCTAAAAC
29

NC_013974_15
NC_017173_13
NC_017175_13
NC_017178_17
NC_017179_17
NZ_CM000441_16
NZ_CM000604_10
NZ_CM000637_7
NZ_CM000657_16
NZ_CM000658_16
NZ_CM000659_15
NZ_CM000661_16
NZ_CP010888_14
NZ_CP010905_13
NZ_LN614756_13
TTACCATCTATTTGTTGCCATCCTGT
26

NC_013974_2
NC_013974_3
ATGGTAAAAAATATTACTTTAATACTAACACT
32

NC_013974_4
TAGTAATAATTTATAGCAAGTAAGAAATTTAGGAAGTAGGAAGTTTA
47

NC_014010_1
AGTATAGCACTCTGGTGATTGAGAGCCTAGAGCAAC
36

NC_014010_3
AGTATAGCACTCTGGTGATTGAGAGCC
27

NC_014011_1
GTGCTCAACGCCTTACGGCATCAGAGGTTATATCAC
36

NC_014012_5
GTTCACTGCCGCACAGGCAGCTTAGA
26

NC_014033_4
GTTGTATATCATTCCTTTCCTACATCAAACCACAAC
36

NC_014034_1
ACCTCTCCCGCCAGTAAGCGGATTGAGAC
29

NC_014034_2
NC_014034_3
GCCCAGACACCTCTCCCGCCAGTAAGCGGATTGAGAC
37

NC_014034_4
NC_014034_5
GTCGCTCCCCCCGCGGGGGCGTGGATCGAAAC
32

NC_014034_6
GGTTCAGTCCGCCGTCGTCTTGGCGGTGATGTGA
34

NC_014041_1
CTTCCAGACCATTCCATCAAACAACTAGGATTGAAAC
37

NC_014041_4
CCTGTGAATCCAGTACTAAAAGTACAATTCTGAAAGCAATTCACAAC
47

NC_014098_1
CCTTCAACGGGGCCGCGGGGTGAACCCGCGGAGTCAC
37

NC_014098_2
CCTTCAACGGGGCCGCGGGTTCAACCCGCGGAGCTGCG
38

NC_014098_3
NC_014098_4
GTTTCCATTCCTCATAGGCACGCTACGAAC
30

NC_014106_1
GGATCACCTCCACACACGTGGAGAATAC
28

NC_014106_2
NZ_CP002427_1
NZ_CP002427_2
NZ_CP012381_2
AGGATCACCTCCACATACGTGGAGAATAC
29

NC_014106_3
AGGATCACCTCCACACTCGTGGAGAATAC
29

NC_014122_1
NC_014122_10
NC_014122_13
NC_014122_15
NC_014122_2
NC_014122_6
NC_014122_8
NC_014122_9
GTAAAATAACGCCCCTAAGGGGATGGAAAC
30

NC_014122_11
NC_014122_12
NC_014122_3
NC_014122_4
GTTTGAATCGCCAGTCCATTAAAACAAGGATGGAAAC
37

NC_014122_5
NC_014122_7
GTTTCCATCCTTGTTTTAATGGACTGGTGATTCAAAC
37

NC_014125_1
GTTAACTGCCGCACAGGCAGCTTAGAAG
28

NC_014147_1
NC_014147_2
NZ_CP007669_1
NZ_CP008804_1
TTTCTAAGCGACCTGTGCGGTCGTGAAG
28

NC_014148_3
GCTTCAATGGGGCCGCGCTTGGTTAGCGCGGAAGAC
36

NC_014150_2
ATTTCTAATCTAACCATACTGGAATGTAAAA
31

NC_014152_3
GTTTCCGTCCCCTTACGGGGATAAGGAAGATTAAAC
36

NC_014152_4
NC_014152_5
NC_014152_6
NC_014152_7
NC_014377_4
NC_014377_5
NC_014410_1
NC_015589_11
GTTTCAATCCCTTATAGGTAGGCTAAAAAC
30

NC_014160_1
GAAACAATAGAGAAAAATTGAAAG
24

NC_014165_10
NC_014165_14
NC_014165_15
NC_014165_8
NC_014165_9
GGGATCATCCCCGCGTGCGCGGGGAGCAC
29

NC_014165_4
GTTGCGATCCCTCTAGGGGTGATGAGCGGAC
31

NC_014166_1
CTTGAACCAAGACATATGATGTATTGAAAT
30

NC_014205_1
GTAACAACACAAAAAGAATTGAAAG
25

NC_014205_2
CCTTCAATTCTTTCTGTGTTGTTAC
25

NC_014205_4
CTTTCAATTCTTTCTGTGTTGTTACTT
27

NC_014205_5
CTTTCAATTTTTCTAAATTGTTTC
24

NC_014205_7
GTAACAACACAAAAAGAATTGAAGG
25

NC_014205_9
CCTTCAATTCTTTATATGTTGTTAC
25

NC_014206_3
GTTTTTATCGTACCTATGAGGGATTGAAA
29

NC_014206_4
NC_014206_5
NC_014206_6
GTTTTATCTGAACGGAGAGGGATTTAAAG
29

NC_014209_1
ATTTACATCCCTCATAGTTCAGATAAAAC
29

NC_014210_10
NC_014210_11
NC_014210_12
NC_014210_20
NC_014210_7
NC_014210_8
NC_014210_9
GTGCTCCCCGCGCACGCGGGGATGGTCCC
29

NC_014210_13
GTGAGCCCCGCGCACGCGGGGATGAACCG
29

NC_014210_2
GCTCCCCGCGCACGCGGGGATGGTC
25

NC_014212_1
GTCGCAAACAAAAAGCCCCGTAAGGGGATTGCAAC
35

NC_014212_2
GTATTCCCCGCACACGCGGGGATGAACCG
29

NC_014212_3
NC_014212_4
GTCGCAAACCAAAAGCCCCGTAAGGGGATTGCAAC
35

NC_014213_1
NC_014213_2
GTTTCAATCCTCACTCGAGCTTTCGCCCGAGTGCAAC
37

NC_014213_3
GTTTCAATCTCCTACGGAGTATTTACAGCTTATACC
36

NC_014213_4
GTTGCAAAAGCGACTAACCTCGTAGAGGATTGAAAC
36

NC_014215_1
NZ_CP010341_1
NZ_CP010341_2
NZ_LN997841_2
GCCTCAATGAAGGGCCCCTCCAGAAGGAGGGGCAAT
36

NC_014216_2
CGGTTCATCCCCGCGAGTGCGGGGAACAT
29

NC_014216_3
TTTCTGAGCTGCCTGTGCGGCAGTGAAC
28

NC_014218_3
CTCTTCCCCGCACACGCGGGGGTATTTCC
29

NC_014220_2
GTTTCAATCCCACTATGGTTCGATTGGATC
30

NC_014220_3
GTTTCAATCCACGCTCCCGCGCGGGGAGCGAC
32

NC_014221_1
NC_014221_4
NC_014221_5
GTTGCAAAAGGGTCTGCCCCGTCAGGGGATTGAAAC
36

NC_014221_10
CGGTTCATCCCCACGTGTGTGGGGAATAG
29

NC_014221_11
NC_014221_8
GTTTCAATCCCCTGACGGGGCAGATCCTTTTGCAAC
36

NC_014221_2
GTTGCAGCCGCCCTTCGGGGCGGCTGAGGATTGAAAC
37

NC_014221_7
GTTGCAGCCGTCCTTCGGGGCGGCTGAGGATTGAAAC
37

NC_014221_9
CTTTTCCCCACACGCGTGGGGATGAACCG
29

NC_014222_1
GTTTCAATCCTTGTTTTAATGGATTATGCACTGTGAC
37

NC_014222_2
GTTTCAATCCTTGTTTTAATGGATTATGCATTGTGAC
37

NC_014222_3
GTTTCAAATCTACTATAGTCTTATTTCTAGC
31

NC_014228_1
NC_014228_2
NC_014228_4
NZ_LN681227_1
NZ_LN681227_2
NZ_LN681227_4
CGGTTTATCCCCGTACTTACGGGGAACAC
29

NC_014228_5
NZ_LN681227_5
GAGGTCTCCGTAGGTACGGAGATAAACC
28

NC_014246_1
GGCTCATCCCCGCGAGTGCGGGGACCAC
28

NC_014248_4
ATTGCAATTCCAACTAATCCCTATTAGGGAT
31

NC_014307_2
GTGTGTTCCCCGCGTGGGCGAGGATGAGG
29

NC_014307_3
NC_017574_2
NZ_CP010415_2
NZ_CP012939_2
NZ_CP012943_1
GTGTTCCCCGCGCCTGCGGGGATGAACCG
29

NC_014315_3
GGTTCACCGCCGCACAGGCGGTTTAGAAA
29

NC_014318_18
NC_014318_19
NC_014318_20
NC_014318_21
NC_017186_18
NC_017186_19
NC_017186_20
NC_017186_21
NC_018266_17
NC_018266_18
NC_018266_19
NC_018266_20
NC_022116_17
NC_022116_18
NC_022116_19
NC_022116_20
GTTGTCCCCGCACGCGCGGGGCTGGTCCC
29

NC_018266_21
GTCGTCCCCTCGCAAGCGGGGCTG
24

NC_014329_1
NC_016781_1
NC_017031_1
NC_017300_1
NC_017301_1
NC_017303_1
NC_017305_1
NC_017306_1
NC_017462_1
NZ_CP008922_1
NZ_CP008923_1
NZ_CP008924_1
NZ_CP009927_1
NZ_CP010795_1
NZ_CP010889_1
NZ_CP011474_1
NZ_CP012695_1
NZ_CP012837_1
NZ_CP013697_1
NZ_CP013698_1
NZ_CP014543_1
NZ_CP014998_1
NZ_CP015100_1
NZ_CP015184_3
NZ_CP015185_4
NZ_CP015187_3
NZ_CP015192_3
NZ_CP015309_1
NZ_CP016826_1
CTTTTCTCCGCGCACGCGGAGGTAGTTC
28

NC_014355_1
GTGTTCCCCGCGCGAGTGGGGATGAACCG
29

NC_014363_7
GTTTGATTACCAGTCAAAACGACACTGCCCCAAAAC
36

NC_014364_1
GTCGCTCCCTTCGCGGGAGCGTGGATTGAAAC
32

NC_014365_3
NC_014365_4
GTTTCAATCCGCTTCCTCTAGCGGCATCCCTCAATAG
37

NC_014366_3
GCGTTCCCCGCATCTGCGGGGATGAACCG
29

NC_014366_9
GTTCCGGATGCAGCACATATCCCGATAATGTAGACT
36

NC_014374_1
NC_014374_4
NC_014374_5
NC_014374_7
GTTTCAACACCATTCCTTGGTTTC
24

NC_014374_2
GGAAACCACGAGATGGTGTTGCAAC
25

NC_014374_3
GTTACAACACCATCTCGTGGTTTC
24

NC_014374_6
GAATCCGCTCAATGGAATTGAAAG
24

NC_014376_1
AAAGAACATGGACAATCATAAGGAA
25

NC_014377_1
GTTACTAGCTTACCTATGAGGGGTTGAAAC
30

NC_014377_2
GTTACTAGCTTACCTATGAGGGGTTGAAACAT
32

NC_014377_3
GTTTTTAGCTTACCTATGAGGGATTGAAAC
30

NC_014377_7
GTTCTTAGTCTACCTATAAGGGATTGAAAC
30

NC_014378_1
CTTTAAAGAACTATAATTTCGTTTAAGGAATTGAAACG
38

NC_014392_4
GTTTGTAGCCTTCCATTTGGGGATTGAAAC
30

NC_014393_3
CTTTAAATAATACAGTATTCAATATTAAC
29

NC_014408_20
TTACACTTGAAATGCATGTCTCCC
24

NC_014410_4
GTTTCAATTCCTGATAGGTAGGCTAAAAAC
30

NC_014410_5
NC_015555_3
NC_015555_4
GTTTCAATTCCACTATGGTTAGATTAAATC
30

NC_014414_1
GTTTCGATCCACGCCCCTGTGAGGGGGCGAC
31

NC_014471_1
NC_014471_3
NC_014471_4
CTTTCAATTCCATATATTGGATTC
24

NC_014471_2
GAATCCTATAAATGGAATTGAAAG
24

NC_014471_5
NC_014471_6
NC_014471_7
CTTTCTACTCCCTTTTGGGAGTTTC
25

NC_014471_8
GAATCCAATAAATGGAATTGAAAG
24

NC_014483_1
GTCGCACTCTACATGAGTGCGTGGAT
26

NC_014500_1
NZ_CM001976_1
NZ_CM001976_2
GTTTCAATCCACGCGCCTGTGTGAGGCGCGAC
32

NC_014532_1
GTTCGCTGCCGCCCAGGCAGCTCAGAAA
28

NC_014533_1
NC_014533_3
CCCTACCTATTGGGTTAAATAGGAATAGTTGGAAAC
36

NC_014533_2
GTTTCAATCCCGTTTCCAGGATTCATTTAATAGAAAG
37

NC_014533_4
NC_014534_3
GTTTCCATTCTATTAGCTTCCTCCTAAGAGGAAAAG
36

NC_014533_5
NC_014534_2
GTTTCCATTCTGTTAGTTTTCTCCTAAGAGAAAAG
35

NC_014534_5
TGAGCAACGCCAATAGGCAGTAAACCATGATGTAC
35

NC_014537_1
NC_014537_2
NC_014537_3
NC_014537_4
NC_014537_7
NC_014537_8
NC_014537_9
CTTTCAATATTCTATTGAAATCTTC
25

NC_014537_5
CCTTCTATTCTCTTTAGAGATTATC
25

NC_014537_6
GATATTCTCTAAAGAGAATAGAAGG
25

NC_014555_4
NZ_CP011484_2
TTCAATCAAGGGACTTATCACTTTAAT
27

NC_014616_1
GTGGTCAAAGTCATTGATCTGACAGGCATCTGAAAC
36

NC_014624_1
GTTGAAGATTAACATGAGATGTATTTAAAT
30

NC_014624_2
NZ_CP011914_1
NZ_CP011914_2
ATTTAAATACATCTCATGTTAAACTTCAAC
30

NC_014625_1
NC_017384_1
NZ_CP012908_1
NZ_CP016592_1
NZ_CP017622_1
GTCGCTCCCCCCACGGGAGCGTGGATAGAAAC
32

NC_014633_2
GTTGTACTTCCCTAATTATTTTAGCTATGTTACAAT
36

NC_014643_5
CCCTCAATGAAAGTCACCTGTTCTCACAGGTGAGA
35

NC_014643_6
CCCTCAATGAAAGTCACCCATTCTCATGGGTGAGAC
36

NC_014644_1
NZ_AP012332_2
GTATTTCCCGCATACGCGGGGGTGATCC
28

NC_014650_12
NC_014650_3
NC_015660_11
NC_015660_2
NZ_CM001483_11
NZ_CM001483_12
NZ_CM001483_2
NZ_CP012712_3
NZ_CP012712_4
NZ_CP016622_3
NZ_CP016622_4
GTTTCAATTCCTCATAGGTAAGATACAAAC
30

NC_014650_4
NZ_CM001483_3
NZ_CP012712_12
NZ_CP012712_2