Institut de Génétique et Microbiologie

CRISPR details


Home lspNtioe]e a se]e a Home l) xdday=("SaturFAQAMEFAQAe]e a Home ' lysis, r.=iso' tarf ( xdd>Helpe]e a CR'>CB> CR UAe]e a lysis, r.=iso' tarf ( xd>Examp="te]e a"CRIStabfo);c1n;c1nS sro3es CR/' tarf ( xd>IGMe]e a"CRIStabfo);RIStabfass =/=0 ce a</le clasight"idInstitdatuima=0 ce /eekday==bc.paris-sa<title>CR/'mages/igm.'if" bordUPS11"0" 'lspacing'0'"> <sc'stit't de 'UnintenteéRep/he Sud'eight="'120'"</a> <'50'"lign==/=0 ce <h2> Navig Patt r><2PR d"primary_t="datur=0 cel> > a"CRISS s >ONTENT="</eekday="/" >ONTENT="<uagpanmary_t="who);lesh"pNtio Satu r>gpan>NTENT="</]e a"CRISabfo);cabfass > a1nS sr='/'>/eekday="/</head/"r='/'>Hogpanmary_t="who);lesh"pls</h1>speats, der>gpan>N <taba>NTENT="NTENT="Nc1nS "primary_t="subdatur=0 cel> /'>Ho a"CRISc1nS sr='TENT="<u'>/eekday="/</head/"r='TENT="<u'>Hogpanmary_t="blu;lesh"plBrowndas</h1>se]gpan>NTENT="< <taba>NTENT <tabfo);c1ntabfass c1n;c1n> a1nc1nS sr='TENT="<u'>/eekday="/</head/BLAST/s</h1>sBry_tay=(" >ONTENT="<u'>Hogpanmary_t="blu;lesh"plBLASTas</h1>se]gpan>NTENT="< <taba>N <tabfo);c1ntabfass c;c1n> a1nc1nS sr='TENT="<u'>/eekday="/</head/s</h1>FaSck> A <sdateiy=(">ONTENT="<u'>Hogpanmary_t="blu;lesh"plFaSckA <se]gpan>NTENT="< <taba>N <tabfo);c1ntabfass ='/'>Ho a1nc1nS sr='TENT="<u'>/eekday="/</head/s</h1>UtilitiesPatu.=iso">ONTENT="<u'>ogpanmary_t="blu;lesh"pls</h1>sputilitiese]gpan>NTENT="< <taba>N <tabfo);c1ntabfasc;c1n> c1n;c1n> a"CRISc1nS sr='TENT="<u'>/eekday="/s</h1>comfr//" bvscr">ONTENT="<u'>ogpanmary_t="blu;lesh"plMyls</h1>spDBe]gpan>NTENT="< <taba>NTENT <tabfo);NT <tabfasc c1n;c1=/=0 ce a"CRISabfo);cabfass > a1nS sr='TENT="</eekday="/Sernte/"r='TENT="<uogpanmary_t="who);lesh"pls</h1>spficatir>gpan>NTENT="</]e a"CRISabfo);cabfass > a"CRIS sr='TENT="/eekday="/s</h1>comfr/"r='TENT="ogpanmary_t="who);lesh"pls</h1>spcomfr/isose]gpan>NTENT="/]e a"CRIabfo);NTabfass=/=0 ce <ter>h2> Other Tools r><2PR d"primary_tabledatur=0 cel> "CRIS a1nS sr='/'>/eekday="/s</h1>comfr//comfr//s</h1>sComfr/isosPatu.y=(">ON/'>Hogpanmary_t="who);lesh"pls</h1>comfr/r>gpan>N <taba>NTENTtabfo);NT abfas='TE CRIS a"CRIS sr='TENT="/eekday="/s</h1>comfr//Dict/Dict.y=(">Oogpan'TENT="ary_t="who);lesh"pls</h1>Pattrder>gpan>/]e a"CRIabfo);NTabfass="NTES a"CRIS sr='TENT="/eekday="/Sernte/"r=ogpan'TENT="ary_t="who);lesh"pls</h1>ficatir>gpan>/]e a"CRIabfo);NTabfass=""""" =/=0 ce <ter>h2> GPMS Leshs r><2PRR d"primary_tabledatur=0 cel ="ve a"CRIS sr='TENT="/eekday="bc.parimlvaa<title>CR/GPMS xdA/"r=ogpan'TENT="ary_t="who);lesh"plGPMS Team r>gpan>/]e a"CRIabfo);NTabfass=e a"CRIS sr='TENT="/eekday="bc.pariminisscrllite> <title>CR"r=ogpan'TENT="ary_t="who);lesh"plTacatmaryotic pDBe]gpan>/]e a"CRIabfo);NTabfass="NTES a"CRIS sr='TENT="/eekday="bc.parib CRISPal-genotyp> acfr'/> <title>CR/ aligpan'TENT="ary_t="who);lesh"plMLVA Web Sernicee]gpan>/]e a"CRIabfo);NTabfass=/=0 ce < <tabntent"> <I>ipt l<B> <a hrage="JavaScript"> today=newss" href="/cj tosay=new D<!-- fun,Iden CheckA lINBOX() {;NTfor (var j= 0; j<te(xddateiforms.length; j++) {; NTfor (var i = 0; i <te(xddateiforms[j].eledates.length; i++) {; NT1000(e(xddateiforms[j].eledates[i].s" h = 'checkbox'){; NT10 te(xddateiforms[j].eledates[i].checked = !(e(xddateiforms[j].eledates[i].checked </0 t}</0} t}<} //--ss=/</i></di <hrabntent"> <I>rel="Satu"abnte /eetion" to(">ign==/nte /ISPR d <UL d <LI>s</h1>spe/p> <brUL <LI>/eekday==#NC_900918_4MENC_900918_4e]e </UL d <LI>/eekday="/</head/s</h1>FaSck> A <sdateiy=(?RefSeqs[]=NC_900918">FaSck> "> <sedate tool/]e a"<LI>p:// tarf (abledilp_Satu"ekday==6</head/HelpTopics<dilp_s</h1>lysis, r.=iso#Satu_</he_loc' Onclick="wicaow.open(=6</head/HelpTopics<dilp_s</h1>lysis, r.=iso#Satu_</he_loc','dilp_Satu','resiz0 ce=yes,status=no,toolbar=yes,loc Patt=yes,scrollbars=yes,ight="720,</a> <450')">ifB> pcolor="#D83020images/igm.gi</head/f" borddilp.jpegllspacing=>Patu mlse l/]FB> >/]e a   /eekday="/</head/s</h1>NtioPatu.y=(">ages/igm.gi</head/f" bordbuttonrddtioSatu.jpegllspacing=>Ntio Patu/]e a"</UL <hrabbrabbrabntent"> <I><B> <a withspacin"r>h2nt"> <I'rel="' /eetion" NC_900918_4>/]e NC_900918_4                                                                                                                 /eekday==#to('>to(ign==/<2PS "primary_t="</headsr=0 cel ight="100%alifasS sr<TABLEmary_tab'</head' BGCOLOR==#e0e0e0' ight="100%alifasS sr<gpanmype="b'<olor:#8888FF' /b>Strain :> <h1>gpan> Aquifex aeolicus VF5abfo)S sr<gpanmype="b'<olor:#8888FF' /b> RefSeq :> <h1>gpan>NC_900918 (chromostio circpace)abfo)S/fasS asS sr<gpanmype="b'<olor:#8888FF' /b>s</h1> id :> <h1>gpan> NC_900918_4e]fo)S sr<bfo)S/fasS asS sr<gpanmype="b'<olor:#8888FF' /b>DRSPR sensus (29 bp) : > <h1>gpan> ="ogpanmype="b'b Ckground:Yrllow'>GTTTTAACTCCACACGGTACATTAGAAACe]gpan>/]fo)S sr<gpanmype="b'<olor:#8888FF' /b>Nu(xdw ofectiorelatts :> <h1>gpan>5 <ter>bfo)S/fasS asS sr<gpanmype="b'<olor:#8888FF' /b>Begin Poselatt :> <h1>gpan> 279264abfo)S sr<gpanmype="b'<olor:#8888FF' /b> End Poselatt :> <h1>gpan> 279555>bfo)S/fasS/=0 ce <ter>bfo)S/fasS asS sr<form"idI'NC_900918_4M a,Iden==6<gi-bini</head/bry_ta<gi' methodI'GET' Nion"'PalinrF'"liTABLEmary_tab'</headsr=0 ce' ight="100%sS asS snt"> <I'spacinstitipt l=0 ce'>279264abfo)S snt"> <I'nospacin=0 ce'>ogpanmype="b'b Ckground:Yrllow'>/b>GTTTTAACTCCACACGGTACATTAGAAACe]b>/]fo)S sr<gpanmype="b b Ckground:Crimsos>CATCTGCAACATATTCAAGTTCAGCTTCAAAACCTT abfo)S snt"> <I'spacinstitipt l=0 ce'>279328abfo)S snt"> <I'withspacin'magnputss" hr'checkbox'etion"'checkedSalinr[]' valun" NC_900918_4_1> >bfo)S/fasS asS snt"> <I'spacinstitipt l=0 ce'>279329abfo)S snt"> <I'nospacin=0 ce'>ogpanmype="b'b Ckground:Yrllow'>/b>GTTTTAACTCCACACGGTACATTAGAAACe]b>/]fo)S sr<gpanmype="b b Ckground:Darkviolet>TTCGTCAAGCTTTACCTCAAAAGTCCTCTCAAACCT abfo)S snt"> <I'spacinstitipt l=0 ce'>279393abfo)S snt"> <I'withspacin'magnputss" hr'checkbox'etion"'checkedSalinr[]' valun" NC_900918_4_2> >bfo)S/fasS asS snt"> <I'spacinstitipt l=0 ce'>279394abfo)S snt"> <I'nospacin=0 ce'>ogpanmype="b'b Ckground:Yrllow'>/b>GTTTTAACTCCACACGGTACATTAGAAACe]b>/]fo)S sr<gpanmype="b b Ckground:Lpt lseagreen>AATAATCAACAACTCTTTGATTTTGTGAAATGGAAGAA abfo)S snt"> <I'spacinstitipt l=0 ce'>279460abfo)S snt"> <I'withspacin'magnputss" hr'checkbox'etion"'checkedSalinr[]' valun" NC_900918_4_3> >bfo)S/fasS asS snt"> <I'spacinstitipt l=0 ce'>279461abfo)S snt"> <I'nospacin=0 ce'>ogpanmype="b'b Ckground:Yrllow'>/b>GTTTTAACTCCACACGGTACATTAGAAACe]b>/]fo)S sr<gpanmype="b b Ckground:Slateblu;>AGAACTCTCAGAAGAACCGAGAGCTTTTTCTATTAAC abfo)S snt"> <I'spacinstitipt l=0 ce'>279526abfo)S snt"> <I'withspacin'magnputss" hr'checkbox'etion"'checkedSalinr[]' valun" NC_900918_4_4> >bfo)S/fasS asS snt"> <I'spacinstitipt l=0 ce'>279527abfo)S snt"> <I'nospacin=0 ce'>ogpanmype="b'b Ckground:Yrllow'>/b>GTTTTAACTCCACACGGTACATTAGAAACe]b>/]fo)S sr<bfo)S snt"> <I'spacinstitipt l=0 ce'>279555>bfo) abTABLE> >bfo)S/fas S asS sr<INPUT"> <sc'middce' LIC "'Pubmit' valun"'BLASTaPalinrs' METHOD='post'> agnputs> <sc'middce' s" h ='reset' valun ='Reset' > agnputss" hr"button" valun""Rentene selr,Iden" onclick="CheckA lINBOX()"> >bfo)S/fas</formsS as <form"a,Iden=gi</head/sion</head>y=(" methodI"GET" Nion""sionDR" onPubmit="popup2();" encs" hr"applram,Cha/x-www-form-unstncoded"ectturn>N agnputss" hr"hidden" tion" deneq" valun"GTTTTAACTCCACACGGTACATTAGAAAC>ON/S sr<INPUT"> <sc"middce" LIC ""Pubmit" size=30 valun""Viewls</h1>spwith the sddatDR" >ON/S/formsSbfo) abfass =BRss="""""="oFORM METHOD="post" ACTION=gi</head/</head>y=(" ENCLIC ""multipart/form-lysil> > INPUT"LIC ""hidden" tion" premi5 daVALUE<METnanguaINPUT"LIC ""hidden" tion" patu"eVALUE<MdefaultanguaINPUT"LIC ""hidden" tion" </head_id"eVALUE<MNC_900918_4">aINPUT"LIC "'hidden' tion"'checked[]' VALUE<NC_900918_4>/fasS sr<TABLEmary_tab'</head' ight="'100%'sS asS sr<gpanmype="b'<olor:#8888FF;'>/b>Ltit faSck> "nequtnce : Till poselatt 279264 (length aINPUT"LIC grisf="/'or' CONTEstitsize' VALUEONT100 SIZEONT3 MAXLENGTHONT4 >Obp)e]gpan>/]<h1>gpan>>bfo)S/fasS asS srCCCAAAGGAATAACCGACAAAGTAAGAACCGTCCTCAAGCGCCAAAATGGCAGTTTTCCGCATATTAGAG=BRsTTTTTATTTTAATTTCTTTTTACAATCTGC=BRs>bfo)S/fasS asS sr<gpanmype="b'<olor:#8888FF' /b>Rpt l faSck> "nequtnce : From poselatt 279555 (lengthaINPUT"LIC grisf="/'or' CONTEipt lsize' VALUEONT100 SIZEONT3 MAXLENGTHONT4 >Obp)e]<h1>gpan>>bfo)S/fasS asS srCCTGCGTGCCTGTGTCTAAAAAATAACGTTTTATCAGCAACTTATTAAACTTCTAACCTTCACGAAATGA=BRsATGTTAATTTCCGCTAACCTGAAGTTCTGC=BRs>bfo)S/fasS asS sr<her>bfo)S/fasS asS sr<gpanmype="b'<olor:#8888FF;'>/b>Prite thdas</h1>"nequtnce : From poselattaINPUT"LIC grisf="/'or' CONTEDeb' VALUEONT279264 SIZEONT8 MAXLENGTHONT12>Obp To poselattaINPUT"LIC grisf="/'or' CONTEFin' VALUEONT279555 SIZEONT8 MAXLENGTHONT12 >Obpe]<h1>gpan>>bfo)S/fasS asS sr>bfo)S/fasS asS sr>INPUT"LIC ""Pubmit" VALUE<MFaSck> "nequtnces">igTD)S/fas</FORM>abTABLE r>bfo)S/fasS asS sr>le clasi "prim BGCOLORab'#ffffff'sS asS sr<FORM METHOD='post' ACTION=i</head/lysis, rs/Output/224324/NC_900918/NC_900918_C/head_4 ENCLIC "'applram,Cha/x-www-form-unstncoded' onPubmit='popup()' LARGETONTE_baSck'r>INPUT"LIC ""Pubmit" VALUE<MDhealayls</h1>actepin=iespfice" > <sablediddce"s</FORM>abfo)S sr<FORM METHOD='post' ACTION='i</head/lysis, rs/Output/224324/NC_900918/Salinrs_4M ENCLIC "'applram,Cha/x-www-form-unstncoded' onPubmit='popup()' LARGETONTE_baSck'r>INPUT"LIC "'Pubmit' VALUE<'DhealaylPalinrs' > <sabl'middce's</FORM>abfo)S/fasS/=0 ce <bfo)S/fasS/=0 ce <bnte /ISPR e]<s="cy><dMETAe]<s="cy><dMETA