Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NC_002754_10                                                                                                                 top


Strain : Sulfolobus solfataricus P2 RefSeq :NC_002754 (chromosome circular)
CRISPR id : NC_002754_10
DR consensus (24 bp) : CTTTCAATTCTATAGTAGATTAGCNumber of repetitions :23
Begin Position : 1809772 End Position : 1811221

1809772CTTTCAATTCTATAGTAGATTAGCAACACATTGCTCATATAACTACACCATTCACTATTGCCTC 1809835
1809836CTTTCAATTCTATAGTAGATTAGCACAATGTATGACTATGGATATCAATGGAGCGTCGGCTTAA 1809899
1809900CTTTCAATTCTATAGTAGATTAGCCAAATAATCTAGCATTTTCTTCATAAAGTTCATTACATAC 1809963
1809964CTTTCAATTCTATAGTAGATTAGCCTTAAAAGTGTTGGAGTTTGTGCAGTTAGTTGAATTTCACT 1810028
1810029CTTTCAATTCTATAGTAGATTAGCGTTATTCCTAATTGTTTTCGGAAATTATTTTGAGAATGAA 1810092
1810093CTTTCAATTCTATAGTAGATTAGCGCCGTACTGACTTCTCCCCTGCCAGCGAGGGTTCTCCTCAT 1810157
1810158CTTTCAATTCTATAGTAGATTAGCTTCCCCACCATTATGTACCACTATTATGCTTCCATTTATT 1810221
1810222CTTTCAATTCTATAGTAGATTAGCATGTTCTTTTTCCAGAACTGTAACTATAATTTTGTTGATA 1810285
1810286CTTTCAATTCTATAGTAGATTAGCTATTTTTGCGTATTTACACGATTTATTTATTTCGCAGAATT 1810350
1810351CTTTCAATTCTATAGTAGATTAGCAGTGATGGTACTACGACCGTGAAAATGAGTTGAAAAAA 1810412
1810413CTTTCAATTCTATAGTAGATTAGCCATCACGCAGAATAATGGTTCAGGTAACTTTTTAAGG 1810473
1810474CTTTCAATTCTATAGTAGATTAGCTGATTATATTCAAGGACAATATGTTGAAACGCCGATTTTAT 1810538
1810539CTTTCAATTCTATAGTAGATTAGCAGATGCTATTGGAGGATTTCACCAGGTTGGGTTATAATGTCAAATA 1810608
1810609CTTTCAATTCTATAGTAGATTAGCTCAGAGTTTTTTTATTTTTTCTATTTGAAATTAAGCACG 1810671
1810672CTTTCAATTCTATAGTAGATTAGCTTGGGTGTTTTGTTTAGGTTTGAAAAAGATTATCTTATTTTCT 1810738
1810739CTTTCAATTCTATAGTAGATTAGCCCAACGGCTCTTACGCCCTCCTCGGCATGTACAACGGGACG 1810803
1810804CTTTCAATTCTATAGTAGATTAGCAAGATACCACAACACTTGGAGTTAATGCATTATTGAATATGGATACAT 1810875
1810876CTTTCAATTCTATAGTAGATTAGCGGAAAGGCTAATGGAGACAAAAAGAAGTCTAAAAAGCAG 1810938
1810939CTTTCAATTCTATAGTAGATTAGCTTCTTCAGCTTCTTCCCAACGCTATATGTGCTATTAGGTGTAAC 1811006
1811007CTTTCAATTCTATAGTAGATTAGCCGGCACAGTACTACTATCTGAAAGTGTTGCATCTCCAAATA 1811071
1811072CTTTCAATTCTATAGTAGATTAGCAACACGTCCTTTTTCATTTGTAATATCTGAACCTGGAA 1811133
1811134CTTTCAATTCTATAGTAGATTAGCCCTAATATCCTCGGGTACTTATAGAACCCTCCTTCTGGTC 1811197
1811198CTTTCAATTCTATAGTAGATTAGC1811221
Left flanking sequence : Till position 1809772 (length bp)
TACATTTAATCTAGTAGATACACTTATTTACACTATAGATTTATTTTTAAGGAGGTGATTTTGGGTCTAC
CGTTTAGGGCGGGGAGGAAGTCATCTTCTA
Right flanking sequence : From position 1811221 (length bp)
CTGTTAGTAAGCCCCTTGCTACAACTCTATAGAAGTGCGGGTTTTAAACAGCTGTTTGAGAATATAAACA
TGGGGTAAAAAAGCTACAACTCTATAGAAG

Print the CRISPR sequence : From position bp To position bp