Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NC_009697_11                                                                                                                 top


Strain : Clostridium botulinum A str. ATCC 19397 "Hall" RefSeq :NC_009697 (chromosome circular)
CRISPR id : NC_009697_11
DR consensus (30 bp) : ATTTAAATACATCCTATGTTAATGTTCAACNumber of repetitions :3
Begin Position : 2256155 End Position : 2256315

2256155GCTTAAATACATCTTATGTTACTGTTCAACACGTAGGAAAGAAAATGGAATCTATAGGTAAGGATA 2256220
2256221ATTTAAATACATCCTATGTTAATGTTCAACTTTAATATTTTTTCTATATCCATAGGCTTAAAATC 2256285
2256286ATTTAAATACATCCTATGTTAATGTTCAAC2256315
Left flanking sequence : Till position 2256155 (length bp)
TTAACTTTAAAAACTATAAATCTTTAATTTTTTATGAAACTCCTTCTCCTGCTATCCAAGGAGTAATAGA
TTCACACTAAATCAAATACTTGAGTTCTCT
Right flanking sequence : From position 2256315 (length bp)
CATAGTAAAATAGCCATTCTTTAATTTCAAGGATATCATACAACCATTGATTTTACAAGATTTTAAAGAA
ATTTTTCCAAGTAGTTTTGCTTTTTACAAA

Print the CRISPR sequence : From position bp To position bp