Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NC_011978_4                                                                                                                 top


Strain : Thermotoga neapolitana DSM 4359 RefSeq :NC_011978 (chromosome circular)
CRISPR id : NC_011978_4
DR consensus (30 bp) : GTTTCAATACTTCCTTAGAGGTATGGAAACNumber of repetitions :7
Begin Position : 704816 End Position : 705245

704816GTTTCAATACTTCCTTAGAGGTATGGAAACCGTAGTTCCTCACGGTGCCGGAGCAAACCTCGAACTC 704882
704883GTTTCAATACTTCCTTAGAGGTATGGAAACTGTTTCGTGTAAGTGTGAATCTCAGAACGTTGCCTT 704948
704949GTTTCAATACTTCCTTAGAGGTATGGAAACTCTTGAGGGGGTGAGGGTTGATCTTCTTTCCACCTC 705014
705015GTTTCAATACTTCCTTAGAGGTATGGAAACAAAGGACACTGTCGTATATGGTAGGACATGACGGCACCGA 705084
705085GTTTCAATACTTCCTTAGAGGTATGGAAACTTTTTCTTTGCGTGAAGTAAGCGTTTGGGAATTCT 705149
705150GTTTCAATACTTCCTTAGAGGTATGGAAATTGAGCCATGAGCCAGGCTTCTCTTTTACAATTAGCA 705215
705216GTTTCAATACATCCTCAGAGGTATGATTTA705245
Left flanking sequence : Till position 704816 (length bp)
TGTGTGTTAGAATCACCTGTGATGAAACACCTTCTGTATGTCCTCATATATTCTTGCTTTTTGAAATGCT
TTGTGGTATAATTTCTCTGAAATCCAACGG
Right flanking sequence : From position 705245 (length bp)
CCCACCAAAAGTATCCTGTGCTCTGACCTCAAAACATCCTCATCCCTAATCCTGTTGTACCGGGGGAGGC
AGGGGGATTGAATATGAGAATATTCGTTAA

Print the CRISPR sequence : From position bp To position bp
CRISprouie alue" siz <'tr><'D">