Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NC_015758_4                                                                                                                 top


Strain : Mycobacterium africanum GM041182 RefSeq :NC_015758 (chromosome circular)
CRISPR id : NC_015758_4
DR consensus (36 bp) : GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACNumber of repetitions :30
Begin Position : 3095752 End Position : 3097922

3095752GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACTCGGGCACGGCCGAAACACCGCGCGAAGGGCGGTTCAA 3095825
3095826GTTTCCGTCCCCTCTCGTCGTTTTGGGTCTGACGACTGGGAGGATGTCACTCGGACATAGCTGTCATCGGCGGTGT 3095901
3095902GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGAGGACATGGAGCAGTAGCGTGGCTGTGGTGTGGCGGGCGATATGC 3095977
3095978GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACTGCTGCACCTCCCGCACCCGGTGCGATTCTGCGTCCA 3096050
3096051GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCCCGATAGTCGCGCTCGTCCATGTCCCACCATGAGG 3096122
3096123GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACTACCTGATAGAAGCCGGAAAGCTCCGTGCCGTCAG 3096193
3096194GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACAGGGCACTGGACCTGTATGAGGCACAGATGGCGTACTA 3096267
3096268GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACGGCTTGTCATCGACTTCGGTGCCTGCGTCGGATGGT 3096339
3096340GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACAATCGGCCCGCCAGGCGCGCCGTGACGCAATTACCA 3096411
3096412GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACTCGCGGAAGTCCGCCGTGTCGGCGACGAGTGGATGCAA 3096485
3096486GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCTGGCGTATCCGTGGCTCTGTATGCCGCTGCTCGTCGTCGG 3096562
3096563GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACACTTGCGCGCACAACGCATCCGCCATCCACGGGGC 3096633
3096634GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCTGAAAGGGGGACTGTGGACGAGTTCGCGCTCAAAAT 3096706
3096707GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACGCGTGAATAAGATTGTCAGGCTGGTGCTGCGTTTCCGT 3096780
3096781GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACACTCTCAACCGCGCCACGCTCAAAAAAAGTGTTATTGA 3096854
3096855GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCCGCTGGGGGCAGGCCCAGGTGGGACGGTTCCTCGC 3096926
3096927GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACTTCGGGAGCATGCCGCAGCTGCGGATGTGGTGCTGGATTTCGA 3097005
3097006GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACACGTTGGAAGCGTTTCGAGCGTACGGACTTTCCGGATGCAG 3097082
3097083GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACTTGACTCAGACCCCAGCGCCAACTTGCCCACCATCCGC 3097156
3097157GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACAGGCGCTTCGACGGTGTGGGCGAGGTGACTTCGCAAAG 3097230
3097231GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACTGCGTCAAGTGCGGCACCGCCGTCATGTCGGTGTCGA 3097303
3097304GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACTTGAACACGCCGATACCTATTTGGTCGGGAGTGATAAA 3097377
3097378GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACTGACAGGGTGCGGTGGTCGCTGATCGGCTCCCCGA 3097448
3097449GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCGGACTTGATCGACGCGAACCTGTCTGACGCGAACCT 3097521
3097522GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACGGCTGGAAAAGGGCGCGGGGCAACCGCATCGTCAAGA 3097594
3097595GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACGCGTTGTGGTCGTGTCGTGGAGCCTGTATTTCGCTG 3097666
3097667GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCATTAGTTGGTGTTGTGATCGCTAAACGCCGGGGCA 3097738
3097739GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCTATCCGCGGGAAGAGATCACGAATCCGGCGTCGAAGG 3097812
3097813GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACATGCTGAGCTGAGGCGCCGGATGATGGTGGTGCTGAAG 3097886
3097887GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC3097922
>
Left flanking sequence : Till position 3095752 (length bp)
GGCGGGGTCATTTCATGACCAAACGTCCTCACCGTCAACGCCGCCATCATGCTCATCCTGAATGCCGGTC
AACAGACGCGGTGGCGACCCAGTCGTCGTA
Right flanking sequence : From position 3097922 (length bp)
TGACAGGGTGCGGTGGTCGCTGATCGGCTCCCCGAGTTTCCGTCCCCTCTCGGGGTTTCCGTCCablemlCckgTTTCCGGd>ACTCGCTGATCGGd>TGCTTA
p)