Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NC_016860_3                                                                                                                 top

CFO1li/-urlencoded" return> bnGTTTATCCCCGI> CFO1li/-ur(gSR" o ENC"View multipart C-,'he VALUEsemdertabl SIZEsem8 MAXLENGTHsem'borbp To pVALUEsemder> bp'c/table> CRTDon="/cribnGT>< wi#ffffff'#8888FF'> CFO1l,'help_ps/Outq" /7abl74/  &nb/  &nb_C/-ur(_3o ENC"View'coded" return> RISPpounie lue= size
Strain : Salmonella enterica subsp. enterica serovar Typhimurium str. T000240 RefSeq :NC_016860 (chromosome circular)
CRISPR id : NC_016860_3
DR consensus (29 bp) : CGGTTTATCCCCGCTGGCGCGGGGAACACNumber of repetitions :15
Begin Position : 3100510 End Position : 3101393

3100510CGGTTTATCCCCGCTGGCGCGGGGAACACGCACCTCGAAACGGTTTTAAAACACTACCGTTT 3100571
3100572CGGTTTATCCCCGCTGGCGCGGGGAACACTGGACCGATGGGGCCAACATCGCCGAACGTGG 3100632
3100633CGGTTTATCCCCGCTGGCGCGGGGAACACGTTACGTTCGGTAAATGGAAAGCGGCGAATAT 3100693
3100694CGGTTTATCCCCGCTGGCGCGGGGAACACCCAGAAAGTGCCGGTAGTGCCTGATGAACGAC 3100754
3100755CGGTTTATCCCCGCTGGCGCGGGGAACACCGCGCCCACTTCCGTAAAATACAGATAATCCA 3100815
3100816CGGTTTATCCCCGCTGGCGCGGGGAACACGGTAATTTCTCATCTAACAGCCTGTACGCCTC 3100876
3100877AGGTTTATCCCCGCTGGCGCGGGGAACACGAATCTAATGCAACAGATGAATAAACACGTAA 3100937
3100938CGGTTTATCCCCGCTGGCGCGGGGAACACTCTTTATCGTCAATGCGAAATTTTCCGCGACG 3100998
3100999CGGTTTATCCCCGCTGGCGCGGGGAACACTCCCATTCACCAACAACAATATCGCCCTGCAA 3101059
3101060CGGTTTATCCCCGCTGGCGCGGGGAACACCGTTGCGTCAGGTTGATCCAGTGCGTCAGCGG 3101120
3101121CGGTTTATCCCCGCTGGCGCGGGGAACACACTTCCTTCAGTCTTAACGATAATCCGCAACG 3101181
3101182CGGTTTATCCCCGCTGGCGCGGGGAACACGAGGGGATAGGAGTTACGATCCAGCCTGGTTG 3101242
3101243CGGTTTATCCCCGCTGGCGCGGGGAACACGTGGTTGCAGACCAATCAGCCCGCCAGCGGTT 3101303
3101304CGGTTTATCCCCGCTGGCGCGGGGAACACCAGCACGAAAAATTATTTACTGTCGTTGCTCA 3101364
3101365CGGTTTATCCCCGCTGGCGCGGGGAACAC3101393
"ubmit""View'GGTTTA'Cus" 016860_3/td>VALUEV   &n' BGCOLOR='#e0e0e0' width=100%>Begin Position : VALUEsemert SIZEsem3 MAXLENGTHsem4> bp)'color:#8/table>Begin Position : RBLE> f
  • withd>VALUEsemert SIZEsem3 MAXLENGTHsem4> bp)'c/table>
  • Begin Position : aCGCue="e : From p
    valuecribnGT> ' CFO1l,'help_ps/Outq" /7abl74/  &nb/_14> onte="Co'c/>onte="Co