Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs Nge=tname=("January"); else if (x[at]igmors.u-psud.fr'/> CRISPR details Ab >CRISPR detail '"conten/HelpTopicsB> lp_ref='/ finder,.Desc' tar; xdy>Helpndex.php?page= las'las'>Nge=tname=("January"); else if bc.ptic'>Cc.ptic UxdmA/dnrpage=aboutlas'>Nge=tname=("Januarconten/HelpTopicsBexampspr_ref='/ finder,.Desc' tar; xd>Exampsprrs.u-p, reppage=aboutlas'>Nge=tname=("Januasrc="/imagess IGMdmA/d, reppage=abreppageer=0 / Navig,Clus las2el="ellspacing="> > d, rep>Ng >nalysis,me=("Janu"/" >nalysis,m=nepanpacing="whdivref="'/ind e if laepan>alysis,memA/d, repage=aboageer= > dCRISe=("Janu"/conten/"e>CRISPRepanpacing="whdivref="'href='/identificalaepan>anrpaga>alysis,alysis,aas'>Nellspacing="sub></u <t> RISPR d, rep <title>Clysis,m=ISe=("Janu"/conten/"e>Clysis,m=ISPRepanpacing="bluvref="'hBrow xdref='/indepan>alysis,mnrpaga>alysi nrpage=aboutpageer=0outlas'> d<t <title>Clysis,m=ISe=("Janu"/conten/BLAST/ref='/iBcint el" >nalysis,m=ISPRepanpacing="bluvref="'hBLASTdref='/indepan>alysis,mnrpaga>a nrpage=aboutpageer=0olas'> d<t <title>Clysis,m=ISe=("Janu"/conten/ref='/F();k'>HAript></i> el">nalysis,m=ISPRepanpacing="bluvref="'hF();kAriptndepan>alysis,mnrpaga>a nrpage=aboutpageer= >CRISPR d<t <title>Clysis,m=ISe=("Janu"/conten/ref='/UtilitiesP if.Desc">nalysis,m=ISRepanpacing="bluvref="'href='/idutilitiesndepan>alysis,mnrpaga>a nrpage=aboutpageerolas'>0outlas'> d, rep <title>Clysis,m=ISe=("Janu"/ref='/com.gi/ v1> ">nalysis,m=ISRepanpacing="bluvref="'hMyhref='/idDBndepan>alysis,mnrpaga>alysi nrpage=absi nrpageero0outlas / <x d, repage=aboageer= > d<title>Clysis,me=("Janu"/SerNG0/"e>Clysis,m=Repanpacing="whdivref="'href='/idrizatilaepan>alysis,memA/d, repage=aboageer= > d, reitle>Clysis,e=("Janu"/ref='/com.gi"e>Clysis,Repanpacing="whdivref="'href='/idcom.giisotndepan>alysis,emA/d, reage=absiageer= / <x<ary_h2> Other Tools las2el="ellspacing=0 >></u <t> , reit d<title>CRISe=("Janu"/ref='/com.gi/com.gi/ref='/iCom.giisotP if. el">naRISPRepanpacing="whdivref="'href='/com.gilaepan>anrpaga>alysipage=absi ageer>Cly reit d, reitle>Clysis,e=("Janu"/ref='/com.gi/Dict/Dict. el">nRepanClysis,acing="whdivref="'href='/Clustr>laepan>emA/d, reage=absiageer=s,alyit d, reitle>Clysis,e=("Janu"/SerNG0/"e>RepanClysis,acing="whdivref="'href='/rizatilaepan>emA/d, reage=absiageer=s,,,,, / <x.p<ary_h2> GPMS Lef=s las2ell="ellspacing=0 >></u <t mhYHt d, reitle>Clysis,e=("Janu"src="/imlvaele> <link/GPMS(x[a/"e>RepanClysis,acing="whdivref="'hGPMS Team laepan>emA/d, reage=absiageer=sHt d, reitle>Clysis,e=("Janu"src="/iminis1> lliteitle> <link"e>RepanClysis,acing="whdivref="'hTazatmstem, CAdDBndepan>emA/d, reage=absiageer=s,alyit d, reitle>Clysis,e=("Janu"src="/ibtic DNal-genotyp'>Hess emA/d, reage=absiageer= / forms.length; j++) {b sifor (var i = 0; i < forms[j].ele>forms[j].ele>forms[j].ele>forms[j].ele> tol">uage /tp:xe>ref='/ideable clULi
  • e=("Janua#NC_016863_4t]iC_016863_4rs.u-e=("Janu"/conten/ref='/F();k'>HAript> el?RefSeqs[]=iC_016863">F();k'>HScripte>fr/" tar; =0 >> lp_e if"("Januarconten/HelpTopicsB> lp_ref='/ finder,.Desc#e if_cont_loc' Onclick="wizaow.open(arconten/HelpTopicsB> lp_ref='/ finder,.Desc#e if_cont_loc','> lp_e if','resiz <=yes,status=no,toolbar=yes,loc,Clus=yes,scrollbars=yes,n="rig720, ufc.pdcolor="#D83020 align="left"conten/ alt="I> lp.jpegtd> <>P if m=("FlemFc.p>emA/d   e=("Janu"/conten/ref='//indP if. el">lign="left"conten/ alt="Ibutton"I>inde if.jpegtd> <>/ind P ifemA/d, "y_h2//www.i't/css'xe=(ils'> iC_016863_4>emA/ iC_016863_4                                                                                                                 e=("Janua#tol'>toluage /s2e>Nellspacing="contens Strain :

    epan> Salmon lla bordeica subsp. bordeica serovar Typhimuriumpcrr. UK-1age=aitle RefSeq :

    epan>iC_016863 (chromosind circpeat)age=ai/eeriteritleter> epan> iC_016863_4rse=aitleDR="kesensus (29 bp) :

    epan> s,Repanpcrisp0'btikground:Y llow'>CGGTTTATCCCCGCTGGCGCGGGGAACACndepan>eme=aitleNuday" ofion, t/cluss :

    epan>24pBegin Pos/clus :

    epan> 3062207age=aitle End Pos/clus :

    epan> 3063639_ge=ai/eeri/ 'yoticrF'SguTABLEpacing=0'contens <' n="rig100%riteritl//www.i'> icro to <'>3062207age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>ACGGCTATCCTTGTTGGCGCGGGGAACACndb>eme=aitleATCTTCATATTGCGTGACGCTGCCGATGAACG age=aitl//www.i'> icro to <'>3062267age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_1> _ge=ai/eeriteritl//www.i'> icro to <'>3062268age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACACndb>eme=aitleTCTTTATCAGCTAACCATTTCCAGAACTCGTC age=aitl//www.i'> icro to <'>3062328age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_2> _ge=ai/eeriteritl//www.i'> icro to <'>3062329age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGGTTTATCCCTGCTGGCGCGGGGAACACndb>eme=aitleTATAATATGAATTAATTTTTGCGCATAACCTG age=aitl//www.i'> icro to <'>3062389age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_3> _ge=ai/eeriteritl//www.i'> icro to <'>3062390age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACACndb>eme=aitleTGCCCGTTCTGCCTCTTCGCACTCTCGATCAA age=aitl//www.i'> icro to <'>3062450age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_4> _ge=ai/eeriteritl//www.i'> icro to <'>3062451age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACACndb>eme=aitleTGCGTAATGGGCTACCTGAACTTCACATATCC age=aitl//www.i'> icro to <'>3062511age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_5> _ge=ai/eeriteritl//www.i'> icro to <'>3062512age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGGTTTATCCCCGCTAGCGCGGGGAACATndb>eme=aitleATTAAGCGCGCAAAGTTTGGGTTAATTGGACA age=aitl//www.i'> icro to <'>3062572age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_6> _ge=ai/eeriteritl//www.i'> icro to <'>3062573age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACACndb>eme=aitleCGTATTCGTCACACAGCCCCGTCCAGAAATGA age=aitl//www.i'> icro to <'>3062633age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_7> _ge=ai/eeriteritl//www.i'> icro to <'>3062634age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGGTTTATCCCCGCTGGCACGGGGAACACndb>eme=aitleTAACGAACTGAATAAAATGTCAGAAAGTGACG age=aitl//www.i'> icro to <'>3062694age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_8> _ge=ai/eeriteritl//www.i'> icro to <'>3062695age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGGCTTATCCCCGCTGGCGCGGGGAACACndb>eme=aitleGCAGCTTAGCGACGAAATTAAAACCGAACTCAC age=aitl//www.i'> icro to <'>3062756age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_9> _ge=ai/eeriteritl//www.i'> icro to <'>3062757age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACACndb>eme=aitleTGCCAGTGACTACAGAAGCGTCTCTATCGGGG age=aitl//www.i'> icro to <'>3062817age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_10> _ge=ai/eeriteritl//www.i'> icro to <'>3062818age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACACndb>eme=aitleACCGATAAACAACCGCATAGCCTCTTTCGTTT age=aitl//www.i'> icro to <'>3062878age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_11> _ge=ai/eeriteritl//www.i'> icro to <'>3062879age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGATTTATCCCTGCTGGCGCGGGGAACACndb>eme=aitleTGCTCAATAACGTCGTAAATAGCGTAAGCTGG age=aitl//www.i'> icro to <'>3062939age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_12> _ge=ai/eeriteritl//www.i'> icro to <'>3062940age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACACndb>eme=aitleTATTTCGCCTTCGGCACTGACGTCACCGTCAA age=aitl//www.i'> icro to <'>3063000age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_13> _ge=ai/eeriteritl//www.i'> icro to <'>3063001age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACACndb>eme=aitleGCTCATGTCAAACGCCATCAGCGTTCCGGCAT age=aitl//www.i'> icro to <'>3063061age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_14> _ge=ai/eeriteritl//www.i'> icro to <'>3063062age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGGTTTATCCCCGCTAGCGCGGGGAACACndb>eme=aitleAATCGCCAGCCTCGGAAATATTCCATCCTCCG age=aitl//www.i'> icro to <'>3063122age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_15> _ge=ai/eeriteritl//www.i'> icro to <'>3063123age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACACndb>eme=aitleAGGAACTAAACAGCCTGACCGTTGAGGATCTG age=aitl//www.i'> icro to <'>3063183age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_16> _ge=ai/eeriteritl//www.i'> icro to <'>3063184age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACACndb>eme=aitleACCGGACAAATCTTTTTTTTCCTGTTCCTGTT age=aitl//www.i'> icro to <'>3063244age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_17> _ge=ai/eeriteritl//www.i'> icro to <'>3063245age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACACndb>eme=aitleGGGCACTATGAACGGATCGGCGCTGATGCCGG age=aitl//www.i'> icro to <'>3063305age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_18> _ge=ai/eeriteritl//www.i'> icro to <'>3063306age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACACndb>eme=aitleGGTAAAGCCACACCATTTTTTATTGACCTCGC age=aitl//www.i'> icro to <'>3063366age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_19> _ge=ai/eeriteritl//www.i'> icro to <'>3063367age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACACndb>eme=aitleCTAGGAGGCGTAATGAATACTACGTATCAAAA age=aitl//www.i'> icro to <'>3063427age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_20> _ge=ai/eeriteritl//www.i'> icro to <'>3063428age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACACndb>eme=aitleGTGGTGGCCTCAAATAAATTCGAGCGCTGGAG age=aitl//www.i'> icro to <'>3063488age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_21> _ge=ai/eeriteritl//www.i'> icro to <'>3063489age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACACndb>eme=aitleGAAACGTAAACAGGGTAAGATACAACTCTGCA age=aitl//www.i'> icro to <'>3063549age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_22> _ge=ai/eeriteritl//www.i'> icro to <'>3063550age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACACndb>eme=aitleTGTAAAGGGTGGTCTGGAAGGGGATCGGCAAA age=aitl//www.i'> icro to <'>3063610age=aitl//www.i'with> 'alinput> 'checkedSoticr[]' valu'> iC_016863_4_23> _ge=ai/eeriteritl//www.i'> icro to <'>3063611age=aitl//www.i'no> <'>Repanpcrisp0'btikground:Y llow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACACndb>eme=aitle icro to <'>3063639age=a agTABLE> _ge=ai/eer iteritle'BLASTdyoticrs' METHOD='post'> linput>cript"'midd <' linput> "ReNG0=e selCharac" onclick="CheckArlINBOX()"> _ge=ai/eer"sls'DR" onsub>it="popup2();" enc anlinput> d0=eq" valu'>CGGTTTATCCCCGCTGGCGCGGGGAACAC>naRitle"Viewhref='/idwith the sr); DR" >naRi/formrige=a ageer=0 BRr=s,,,,,
    nINPUTS//EN='hiddec' ENT="'checked[]' VALUE iC_016863_4>eeeritleit" VALUE CF();k'>HS=equcnces">uaTDai/eeragTABLE >_ge=ai/eeriteritl>_ borderJNellsp BGCOLOR=0'#ffffff'>iteritle
    it='popup()' /ARGETat]i_b();k'>_INPUTS//EN="sub>it" VALUE CDntelayhref='/rns,p ieidri <" cript=0 >>idd <"r
    age=aitle
    it='popup()' /ARGETat]i_b();k'>_INPUTS//EN='sub>it' VALUE 'Dntelayhyoticrs' cript=0 'midd <'r
    age=ai/eeri/