Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NC_017635_3                                                                                                                 top


Strain : Escherichia coli W RefSeq :NC_017635 (chromosome circular)
CRISPR id : NC_017635_3
DR consensus (29 bp) : CGGTTTATCCCCGCTGGCGCGGGGAACACNumber of repetitions :15
Begin Position : 3030421 End Position : 3031303

3030421CGGTTTATCCCCGCTGGCGCGGGGAACACAAAACCAAACTTCTCCATAAATTCCATAGCCG 3030481
3030482CGGTTTATCCCCGCTGGCGCGGGGAACACACGCGCGTACCGGATCGCGGACAACAAATTGC 3030542
3030543CGGTTTATCCCCGCTGGCGCGGGGAACACCTGAAACCAGTTGGCTCGTTGTTCTTCTTTGG 3030603
3030604CGGTTTATCCCCGCTGGCGCGGGGAACACGCTGGTTTTGAATCGTCCCGCGCTCGAGACGC 3030664
3030665CGGTTTATCCCCGCTGGCGCGGGGAACACGGCAACATAACGAACAAAATCAACGTCAACCT 3030725
3030726CGGTTTATCCCCGCTGGCGCGGGGAACACTTGCTGAAAAAGAAGGCTCCGGCGTTATCAGT 3030786
3030787CGGTTTATCCCCGCTGGCGCGGGGAACACTAGTTAACTTTTAGACAGAATATCCGTGTACC 3030847
3030848CGGTTTATCCCCGCTGGCGCGGGGAACACGGTTTTACAAGCTTAAATGATTTTAAATTTTG 3030908
3030909CGGTTTATCCCCGCTGGCGCGGGGAACACTCTTTGGTATGAGTGACAAAGAGTTTGACGCC 3030969
3030970CGGTTTATCCCCGCTGGCGCGGGGAACACATTGTCCAGGGTATGTCCGGTCAGGGGAATAG 3031030
3031031CGGTTTATCCCCGCTGGCGCGGGGAACACAATTACCGGGTGTCTCGTGCTCATATGCAGTC 3031091
3031092CGGTTTATCCCCGCTGGCGCGGGGAACACCCGTGTGACGCTCAGCGGCAGAGAGTAAAAAC 3031152
3031153CGGTTTATCCCCGCTGGCGCGGGGAACACTAAAGTAGAATAAAAATATTCGCATAACAGAC 3031213
3031214CGGTTTATCCCCGCTGGCGCGGGGAACACCGCGCCGGTATTTGTCCAGTCGAGGGTTTTGC 3031274
3031275CGGTTTATCCCCGCTGGCGCGGGGAACAC3031303
Left flanking sequence : Till position 3030421 (length bp)
GCTGGCGAAGGCGTCTTGATGGGTTTGAAAATGGGAGCTGGGAGTTCTACCGCAGGGGCGGGGAATTCTA
AGTGATATCCATCATCGCATCCAGTGCGCC
Right flanking sequence : From position 3031303 (length bp)
ACTAAGCATACATATCTGTTTTTAAACAAATTTATTCCACATCAACAATCTACCAACTAAATTCAAACAT
TTCCTTATTTTTAAAGAACGTCTAACTTAT

Print the CRISPR sequence : From position bp To position bp