Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NC_021054_8                                                                                                                 top

Strain : Mycobacterium tuberculosis str. Beijing/NITR203 RefSeq :NC_021054 (chromosome circular)
CRISPR id : NC_021054_8
DR consensus (36 bp) : GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACNumber of repetitions :23
Begin Position : 3121636 End Position : 3123267

3121636GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACACGGACGAGCTGGACCGCATCAGCGATGCTGAGCTGAGG 3121710
3121711GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACTTCGGGAGCATGCCGCAGCTGCGGATGACACGCTCCAA 3121784
3121785GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCACCAGGATCAGCGCCAAGCCAGTTAGCGCAATCCA 3121856
3121857GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCTCCCGGACCATCTGCAGCTCGCCCGGGTCCATGCG 3121928
3121929GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCGGAGTCATCCGCGCGGGCCGGCGCGATTGTTGCCGG 3122001
3122002GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACTGGCGATTTACGACGCTGACGGGAACTCGTGCGAAT 3122073
3122074GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGATCCGCGAAATTCACTGCGCGTTATTCAAG 3122134
3122135GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCCGAGCCGACCATCCGCATCACACCGAAAGGGTTGGCGCAA 3122211
3122212GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACACGTTGGAAGCGTTTCGAGCGTACGGA 3122274
3122275CTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCTCGGACAGCATCTCCCCGGGCGGGCAGCAGATATCCCAT 3122350
3122351GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCGACCCGTGGCCGCCAGGTTGCCGCCGCCGTTGCTCACCTG 3122427
3122428GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCCGCTGGGGGCAGGCCCAGGTGGGACGGTTCCTCGC 3122499
3122500GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACATGAGAATAAGATGTCAGGCTGGTGCTGCGTTTCCGT 3122572
3122573GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACGCTGGGCAGGCACGGCAGGTGGGACGGTTCCTCGC 3122643
3122644GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCAGCGCAGACGGAAGCGTTTCGAGCGTACGGACTTTCCGGATGC