Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NC_021193_6                                                                                                                 top


Strain : Mycobacterium tuberculosis CAS/NITR204 RefSeq :NC_021193 (chromosome circular)
CRISPR id : NC_021193_6
DR consensus (36 bp) : GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACNumber of repetitions :18
Begin Position : 3108469 End Position : 3109751

3108469GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACTCGGGCACGGCCGAAACACCGCGCGAAGGGCGGTTCAA 3108542
3108543GTTTCCGTCCCCTCTCGTGGTTTTGGGTCTGACGACTGGGAGGATGTCACTCGGACATAGCTGTCATCGGCGGTGT 3108618
3108619GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGAGGACATGGAGCAGTAGCGTGGCTGTGGTGTGGCGGGCGATATGC 3108694
3108695GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACTGCTGCACCTCCCGCACCCGGTGCGATTCTGCGTCCA 3108767
3108768GTTTCCGTCCCCTCTCGGGGTTTTGGGTCCGACGACCCCGATAGTCGCGCTCGTCCATGTCCCACCATGAGG 3108839
3108840GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACTACCTGATAGAAGCCGGAAAGCTCCGTGCCGTCAG 3108910
3108911GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACAGGGCACTGGACCTGTATGAGGCACAGATGGCGTACTA 3108984
3108985GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCCGGATCGGTTACCCACGCCGATTTACTGGCCATCGTCGG 3109060
3109061GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACACTTGCGCGCACAACGCATCCGCCATCCACGGGGC 3109131
3109132GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCTGAAAGGGGGACTGTGGACGAGTTCGCGCTCAAAAT 3109204
3109205GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACTTGACACGCCGATACCTATTTGGTCGGGAGTGATAAA 3109277
3109278GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCGGACTTGATCGACGCGAACCTGTCTGACGCGAACCT 3109350
3109351GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACGGCTGGAAAAGGGCGCGGGGCAACCGCATCGTCAAGA 3109423
3109424GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACGCGTTGTGGTCGTGTCGTGGAGCCTGTATTTCGCTG 3109495
3109496GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCATTAGTTGGTGTTGTGATCGCTAAACGCCGGGGCA 3109567
3109568GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCTATCCGCGGGAAGAGATCACGAATCCGGCGTCGAAGG 3109641
3109642GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACATGCTGAGCTGAGGCGCCGGATGATGGTGGATGCGAAG 3109715
3109716GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGAGCTG3109751
Left flanking sequence : Till position 3108469 (length bp)
GGCGGGGTCATTTCATGACCAAACGTCCTCACCGTCAACGCCGCCATCATGCTCATCCTGAATGCCGGTC
AACAGACGCGGTGGCGACCCAGTCGTCGTA
Right flanking sequence : From position 3109751 (length bp)
CGGATGTGGTGCTGGATTTCGAGTTTCCGTCCCCTCTCGGGGTGAACCGCCCCGGTGAGTCCGGAGACTC
TCTGATCTGAGACCTCAGCCGGCGGCTGGT

Print the CRISPR sequence : From position bp To position bp