Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NC_021870_2                                                                                                                 top

Strain : Salmonella bongori N268-08 RefSeq :NC_021870 (chromosome circular)
CRISPR id : NC_021870_2
DR consensus (29 bp) : CGGTTTATCCCCGCTGGCGCGGGGAACACNumber of repetitions :11
Begin Position : 2938495 End Position : 2939134

2938495AGTAAAAGCCCCGCTGGCGCGGGGAACACGCTGGTATTGGTACTATGGTGGGAGGTCATTG 2938555
2938556CGGTTTATCCCCGCTGGCGCGGGGAACACTCTGATAATTCAGGGAAATTCGTCATTCTGAC 2938616
2938617CGGTTTATCCCCGCTGGCGCGGGGAACACCTACCCTAAA