Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NC_023149_5                                                                                                                 top


Strain : Pseudomonas aeruginosa SCV20265 RefSeq :NC_023149 (chromosome circular)
CRISPR id : NC_023149_5
DR consensus (28 bp) : GTTCACTGCCGTATAGGCAGCTAAGAAANumber of repetitions :3
Begin Position : 3034086 End Position : 3034233

3034086GTTCACTGCCGTATAGGCAGCTAAGAAATTACCTTTAAAAGGCTTTAAAAGGCCTTTTAG 3034145
3034146GTTCACTGCCGTATAGGCAGCAAAAAAATGTCTCGAAGTTCATAAGCGGGCTTCGGGCGA 3034205
3034206TTTCACTGCCACATAGGTCGTCAAGAAA3034233
Left flanking sequence : Till position 3034086 (length bp)
TCGTTGCTTGCTCATCAGACACCTCTCTCACGGCGAGGATTTTCGCCTAAATCGGTGTCCGGGATCAGTA
GACCACTACAAAGCCCCGGGCAAGCTGAAA
Right flanking sequence : From position 3034233 (length bp)
CGGCCAGCAGCCCTGAAGTATCGATTGATGCGGTTCGCTGTCGGCCGGGGTCACCAGTCGAAACGAAGTC
CCTTTCCATGGAACTTCGTTGCGGACATGC

Print the CRISPR sequence : From position bp To position bp