Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation

/comB> / isosPpanp whitelink"> CRISPRs e=contas an> sgle e p Home p=contas an> datab Home p=contas an> daaaaa 0> CR' heGPMS L/">s>

N

GPMS Team class="k">Home p=contas an> dU TaysimnterspacnDBhpass="k">Home p=contas an> datab = span" dcrier> r>
class=" GO._tablindex.FdivkaryAagesxdend ?RefSeqs[]=hZ_CP007216">Fdivkaryimagesexden toolk">Hom
  • a href= '/crispr/HelpTop#span_> _loc' Onclick"/clysow.open(td> a href= '/crispr/HelpTop#span_> _loc','a hrespan','resizh='1=yes,status=no,toolbar=yes,loc'50' =yes,scrollbars=yes,alt='U720,ité Pa4is ) df /www.u-a hr.jpegtable clas>Ppan m iflk"F Ho   class=" GO._tablindex. Ppanp /www.i2bc.p> /www.u-buttonu-a span.jpegtable clas> Hom 'er>H hZ_CP007216_1                                                                                                                 r>
    to d' wida> > s alt='U100%ogi> N ' BGCOLORid#e0e0e0' alt='U100%ogi> < olor:#8888FF'erb>Strain :te(xddass=" Salmonella d> ica subsp. d> ica serovar Newpred str. USDA-ARS-USMARC-1927 GCF_000940935=cont < olor:#8888FF'erb> RefSeq :te(xddass="hZ_CP007216 (chromos < olor:#8888FF'erb>cript> id :te(xddass=" hZ_CP007216_1seont < olor:#8888FF'erb>DRs"> sensus (29 bp) : te(xddass=" CGGTTTATCCCCGCTGGCGCGGGGAACAChpass="k"ont < olor:#8888FF'erb>Number ofsoftwr'/0' s :te(xddass="19 0> CRcont /> < olor:#8888FF'erb>Begin Pos'/0' :te(xddass=" 3702942=cont < olor:#8888FF'erb> End Pos'/0' :te(xddass=" 3704068Rcont /> dth='120> CRcont /> 'NZ_CP007216_1a aase, /td>gi-binp> breft >gi' metho 'GET' Nr" c'NA,ClrF SudTABLE

    N s ' alt='U100% spr.css'ble clPS11ght=" '>3702942=cont spr.css'noble cl '> rb>GTGTTTATCCCCGCTGACGCGGGGAACATte(xddont < TTTTCAGCCCTTGCCGACTGCGGAACGCCCCT=cont spr.css'ble clPS11ght=" '>3703002=cont spr.css'withble cl hrenputitle> /checkbox' spr.css'ble clPS11ght=" '>3703003=cont spr.css'noble cl '> rb>CGGTTTATCCCCGCTAGCGCGGGGAAGAChp(xddont < TTCCGGAGTGACTGGTATCGCGACGTATTCAA=cont spr.css'ble clPS11ght=" '>3703063=cont spr.css'withble cl hrenputitle> /checkbox' spr.css'ble clPS11ght=" '>3703064=cont spr.css'noble cl '> rb>CGGCTTATCCCCGCTGGCGCGGGGAACAChp(xddont < TCCACCAGATTTTCAAAATCACGCAGGGCGCG=cont spr.css'ble clPS11ght=" '>3703124=cont spr.css'withble cl hrenputitle> /checkbox' spr.css'ble clPS11ght=" '>3703125=cont spr.css'noble cl '> rb>CGGTTTATCCCCGCTGGCGCGGGGAACAChp(xddont < GTGATTAGCCAGTCTTTAGAGGACATAATCCC=cont spr.css'ble clPS11ght=" '>3703185=cont spr.css'withble cl hrenputitle> /checkbox' spr.css'ble clPS11ght=" '>3703186=cont spr.css'noble cl '> rb>CGGTTTATCCCCGCTGGCGCGGGGAACAChp(xddont < TCACCGCCACGCGGGCCGCTATTGAGCGAATG=cont spr.css'ble clPS11ght=" '>3703246=cont spr.css'withble cl hrenputitle> /checkbox' spr.css'ble clPS11ght=" '>3703247=cont spr.css'noble cl '> rb>CGGTTTATCCCCGCTGGCGCGGGGAACAChp(xddont < AACTCAATGCGCTGGTTTAATCTTTCGTTAGT=cont spr.css'ble clPS11ght=" '>3703307=cont spr.css'withble cl hrenputitle> /checkbox' spr.css'ble clPS11ght=" '>3703308=cont spr.css'noble cl '> rb>CGGTTTATCCCCGCTGGCGCGGGGAACAChp(xddont < ACGATGAGGAGGACGAACCGCAATTTTTCACT=cont spr.css'ble clPS11ght=" '>3703368=cont spr.css'withble cl hrenputitle> /checkbox' spr.css'ble clPS11ght=" '>3703369DrS11" 'withble cl hrenpicont spr/'>os8ACGAle elU03369DPor:#8888Zn TCCCCGCTGGCGCGGGGAACAChp(xddont < ACGATGAGGAGG8CGAACCGCAATTTTTCACT=cont spr.css'ble clPS11ght=" 430>3703368=cont spr.css'withble cl hrenputitle> /checkbox' spr.css'bIvoryght'>3703CA,Clr[03125=c3CA,C3186pr.css'noble cl '> 3703368=cont TCCCCGCTGGCGCGGGGAACAChp(xddont < ACGATGAGGAGG9CGAACCGCAATTTTTCACT=cont spr.css'ble clPS11ght=" 491>3703368=cont spr.css'withble cl hrenputitle> /checkbox' spr.css'ble cviolet>>370" ACG3=cont '>3707030TA.css'noble cl '> 3703368=cont TATCCCCGCTGACGCGGGGAACATte(xddont < TTTTCAGCCCTTG0CGAACCGCAATTTTTCACT=cont spr.css'ble clPS11ght=" 55P007216_1a aase, /td>gi-binp> breft >gi' metho 'GET' Nr" c'NAheckedSA,Clr[]' valu c hZ_CP007216_1_7" Rcont /> spr.css'bWheat>ont G3=con7=c '>TC318 A03=cocss'noble cl '> rb>GTGTTTATCCCCGCTGACGCGGGGAACATte(xddont < TTTTCAGCCCTTGGCCGACTGCGGAACGCCCCT=cont spr.css'ble clPS11ght=" 61'>3703002=cont spr.css'withble cl hrenputitle> /checkbox' spr.css'ble cgreen>on=conC spGht=" GT' val3703 hZcss'noble cl '> rb>CGGTTTATCCCCGCTAGCGCGGGGAAGAChp(xddont < TTCCGGAGTGAC1TGGTATCGCGACGTATTCAA=cont spr.css'ble clPS11ght=" 67'>3703063=cont spr.css'withble cl hrenputitle> /checkbox' spr.css'bLave > valuC 'ClrFC '>3703A318 7030css'noble cl '> rb>CGGCTTATCCCCGCTGGCGCGGGGAACAChp(xddont < TCCACCAGATTT1TCAAAATCACGCAGGGCGCG=cont spr.css'ble clPS11ght=" 73'>3703124=cont spr.css'withble cl hrenputitle> /checkbox' spr.css'bAqua>uC Clr[