Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NZ_CP007222_2                                                                                                                 top

Strain : Salmonella enterica subsp. enterica serovar Montevideo str. USDA-ARS-USMARC-1903 GCF_000940975 RefSeq :NZ_CP007222 (chromosome circular)
CRISPR id : NZ_CP007222_2
DR consensus (29 bp) : CGGTTTATCCCCGCTGGCGCGGGGAACACNumber of repetitions :24
Begin Position : 3598495 End Position : 3599926

CGGTTTATCCCCGCTGGCGCGGGGA921'>3598799
3598495ACGGCTATCCCCGCTGACGCGGGGAACACACGGCAACGGATGCGACCGCCAGCGCGATCCC3598555
3598556CGGTTTATCCCCGCTGGCGCGGGGAACACCCAGCCTCCCGTTACGCATATTTGAGGGTTTT3598616
3598617CGGTTTATCCCCGCTGGCGCGGGGAACACGCGATACGTCAGTCTGACGTGCCAGAACTCGA3598677
3598678CGGTTTATCCCCGCTGGCGCGGGGAACACGCGGCGCTGATTATGATTTCCCGATAATTTAT3598738
3598739CGGTTTATCCCCGCTGGCGCGGGGAACACAGTGCCGATGCGCGGTATCTGGGGAGTTTTGC3598799
359880IOr>Shifase>)> CGGTTTATCCCCGCTGGCGCGGGGA86r'>3598799
359880IOr>tabl
3598739_)> e='bac e=ble'yle='Te' waserround:Yellow'>CGGTTTATCCCCGCTGGCGCGGGGA982'>3598799
359880IOr>>2_)G stan stle'>)> CGGTTTATCCCCGCTGGCGCGGGG9043'>3598799
359880IOr>>asAclG styAtyle=tylelaCo/td>)sAckground:Yellow'>CGGTTTATCCCCGCTGGCGCGG9104'>3598799359880IOr>waseryle=tyyAclastyAclTwaserround:Yellow'>CGGTTTATCCCCGCTGGCGCGGGG916b>>> e='A styleAtyleGrt)>ble'yAtd>)round:Yellow'>CGGTTTATCCCCGCTGGCGCGGGG922AC>awasetable'tyle
ACGGCAACGGATGCGACCGCCAGCGCGATCCC3598555
3598556CCAGCCTCCCGTTACGCATATTTGAGGGTTTT3598616
3598617CGGTTTATCCCCGCTGGCGCGGGG928CGCGATACGTCAGTCTGACGTGCCAGAACTCGA3598677
3598678