Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NZ_CP007329_1                                                                                                                 top


Strain : Salmonella enterica subsp. enterica serovar Enteritidis str. EC20120002 GCF_000624395 RefSeq :NZ_CP007329 (chromosome circular)
CRISPR id : NZ_CP007329_1
DR consensus (29 bp) : CGGTTTATCCCCGCTGGCGCGGGGAACACNumber of repetitions :10
Begin Position : 2954745 End Position : 2955322

2954745GTGTTTATCCCCGCTGACGCGGGGAACACTATTTATAAGCGTGTCATCTATGCAACCCAAC2954805
2954806CGGTTTATCCCCGCTGGCGCGGGGAACACACCTGCCCGACCCAATAAGGAGGCCCTCGTGA2954866
2954867CGGTTTATCCCCGCTGGCGCGGGGAACACGGCCGCTGGTCAAATTCCCAATCTGAGCAATC2954927
2954928CGGTTTATCCCCGCTGGCGCGGGGAACACATAGCCCCGGCAGCGATAGCTAAACCAGTTCC2954988
2954989CGGTTTATCCCCGCTGGCGCGGGGAACACGCCTCAAAATCTCTCGGTGAGATGTAAGCGTC2955049
2955050CGGTTTATCCCCGCTGGCGCGGGGAACACACCAGTGGTCAGCGGCGGATGAATTTGCCCTG2955110
2955111CGGTTTATCCCCGCTGGCGCGGGGAACACGAGAATGCTCATGCGCGTGAGCGCCATATATT2955171
2955172CGGTTTATCCCCGCTGGCGCGGGGAACACCATGGCAATTTTACGGCGGACGTGCTCGCTCT2955232
2955233CGGTTTATCCCCGCTGGCGCGGGGAACACAGGCGGACCGAAAAACCGTTTTCAGCCAACGT2955293
2955294CGGTTTATCCCCGCTGGCGCGGGGAACAC2955322
Left flanking sequence : Till position 2954745 (length bp)
GGCGAATTGAGCGCCGTAGCCGCGATGTAGTACGGATAATGCTGCCGTTGGTAAAAGAGCTGGCGAAGGC
GGAAAAAACGTCCTGATATGCTGGTGAAAC
Right flanking sequence : From position 2955322 (length bp)
ACTAAAACTATATATTTGTTCTAAAAGCCCTTTTTTACTACATAACAAACTACCAACGGTAAGATAACAA
TTCCTTATCATTAAAGAACATTCAACTTAT

Print the CRISPR sequence : From position bp To position bp

NAeshek reTML NAeshek reTML