Institut de Génétique et Microbiologie

CRISPR details


='/ href='/About/h1> ='/ href='/ FAQ="kFAQ= + " "r> ='/ href='/ 4 Help + " "r> ='/ hre href='/C ='/ hre href='/Exampext + " ISPR,> ='/ hre href='/IGM + " ISPR,> ='/ PR,> = = "p/cells" idtitut einugescells"ef='/nda paris-saclatle>CRISP/'es/igm.gif' border=UPS11 ali'acing=0 '0' Sud'ht="60"'120' > Navigttern /di2detaimary_tabl="einu cellsp> < ISPR,f=' >ENT="CRIref='/nda"/" >ENT="CRIre="pany_tabl="wh /d"pan>NT="CRIre+ " ISPR, ='/ h = = < ref='/4 NT="CRIr"r> a>NT="C "r> ='/ hre> = = "hre hre < rehref='/4 = = "h hre < rehref='/4 = = 4 .o-88">ENT="CRIre he"pany_tabl="blu NT="CRIr"r> a>N "r> ='/ hre> = =h hre "hre hre < ISPR,href='/4 = =h"hre hrp/cells" ISPR, ='/ h = = < ref='/4 NT="CRIre+ " ISPR, ='/ h = = < ISPRf='/4 <"/4 NT="CRIe+ " ISPR ='/ "C = = p/cells"<>

Other Tools /di2detaimary_table" beinu cellsp> ISPRf= < ref='/4 Ee"pan e+ " ISPR ='/ "C = = RINT=f= < ISPRf='/4 e+ " ISPR ='/ "C = = RIIIII p/cells" <>

GPMS Leets /di2deetaimary_table" beinu cellsp erif= < ISPRf='/4CRISP/GPMSdat=/"/4e"pane+ " ISPR ='/ "C = = Rf= < ISPRf='/4CRISP"/4e"pane+ " ISPR ='/ "C = = RINT=f= < ISPRf='/4 CRISP/ign="pan<T="CRI_tabl="wh <heet"d/MLVA Web Sernice +"pan>e+ " ISPR ='/ "C = = p/cells"<table nt"> <I><B> lang <a href=="JavaScript"> today=new Da href="/css/jdaysnew Date<!-- funentif CheckAslINBOX() { "Cfor (var j= 0; j<xddateinfoforms.length; j++) { "Cfor (var i = 0; i <xddateinfoforms[j].eleeinfs.length; i++) { "C0) x(ddateinfoforms[j].eleeinfs[i].href =a 'checkbox'){ "C0) xddateinfoforms[j].eleeinfs[i].checked = !(ddateinfoforms[j].eleeinfs[i].checked/b><) x}><)} x}>} //--= p/></div> <hre nt"> <I><B>="styp> "e nt""ef=n" contop">="rip/nt""eR deta <ULta <LI>h1> </sts <br></ULt<LI>ef='/nda #NZ_CP007598_1"kNZ_CP007598_1 + " </ULta <LI>ef='/nda"/ead> </h1> </Fripk Ascrieinfophp?RefSeqs[]=NZ_CP007598">Fripk <scrieeinf toole+ " I<LI>/www tarxdde" b clp_p> "='/nda (ead> </HelpTopicsv clp_h1> </is, repe.o-88#p> _ead>_loc' Onclick="wtioow.open( (ead> </HelpTopicsv clp_h1> </is, repe.o-88#p> _ead>_loc',' clp_p> ','resizells=yes,status=no,toolbar=yes,locttern=yes,scrollbars=yes,t="60"720,> <div450')">=f<a tcolor="#D83020ges/igm.gif" ead> </border= clp.jpegpacing=0 >>P> m if le+F<a >e+ "    ef='/nda"/ead> </h1> </day P> .php">s/igm.gif" ead> </border=buttonr= ay p> .jpegpacing=0 >>day P> e+ " I</ULt<hre bre bre nt"> <I><B> <a hrewithcing=0" <h2> <I><B'="sty'"ef=n" co NZ_CP007598_1>e+ " NZ_CP007598_1                                                                                                                 ef='/nda #top'>top="rip/i2df=imary_tabl="ead> <s cellsp t="60"100%gn== =f='/<TABLEy_table"'ead> <' BGCOLORa #e0e0e0' t="60"100%gn== =f='/<"pany="tex"'eolor:#8888FF'"eb>Strain :h1> CR"pan> Salmontlla lass ica subsp. lass ica serovar Eass itidisy="r. 77-1427 GCF_000280315 ='/f='/<"pany="tex"'eolor:#8888FF'"eb> RefSeq :h1> CR"pan>NZ_CP007598 (chromosay circed S) ='/f/= =f= =f='/<"pany="tex"'eolor:#8888FF'"eb>h1> </pid :h1> CR"pan> NZ_CP007598_1 +='/f='/< ='/f/= =f= =f='/<"pany="tex"'eolor:#8888FF'"eb>DR detsensus (29 bp) : h1> CR"pan> RIe"pany="tex"'bISkground:Ytllow'>CGGTTTATCCCCGCTGGCGCGGGGAACAC +"pan>e+='/f='/<"pany="tex"'eolor:#8888FF'"eb>Nuweek ofion, ="serns :h1> CR"pan>10 <> < ='/f/= =f= =f='/<"pany="tex"'eolor:#8888FF'"eb>Begin Pos"sern :h1> CR"pan> 4565718 ='/f='/<"pany="tex"'eolor:#8888FF'"eb> Ead Pos"sern :h1> CR"pan> 4566295< ='/f/= =f/cells"<> < ='/f/= =f= =f='/<form idt'NZ_CP007598_1" aentifa (egi-bin ead> </btabt.egi' methodt'GET' N" co'indrorF' n=TABLEy_table"'ead> <s cells' t="60"100%=f= =f='> <I><B'cing=0tut langcells'>4565718 ='/f='> <I><B'nocing=0cells'>e"pany="tex"'bISkground:Ytllow'>eb>GTGTTTATCCCCGCTGACGCGGGGAACAC +b>e+='/f='/<"pany="tex" bISkground:Darksliptgray>TATTTATAAGCGTGTCATCTATGCAACCCAAC ='/f='> <I><B'cing=0tut langcells'>4565778 ='/f='> <I><B'withcing=0'es/nput href='checkbox'=n" co'checkedSndror[]' valuco NZ_CP007598_1_1> < ='/f/= =f= =f='> <I><B'cing=0tut langcells'>4565779 ='/f='> <I><B'nocing=0cells'>e"pany="tex"'bISkground:Ytllow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACAC +b>e+='/f='/<"pany="tex" bISkground:Llangp k>ACCTGCCCGACCCAATAAGGAGGCCCTCGTGA ='/f='> <I><B'cing=0tut langcells'>4565839 ='/f='> <I><B'withcing=0'es/nput href='checkbox'=n" co'checkedSndror[]' valuco NZ_CP007598_1_2> < ='/f/= =f= =f='> <I><B'cing=0tut langcells'>4565840 ='/f='> <I><B'nocing=0cells'>e"pany="tex"'bISkground:Ytllow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACAC +b>e+='/f='/<"pany="tex" bISkground:Rosybrown>GGCCGCTGGTCAAATTCCCAATCTGAGCAATC ='/f='> <I><B'cing=0tut langcells'>4565900 ='/f='> <I><B'withcing=0'es/nput href='checkbox'=n" co'checkedSndror[]' valuco NZ_CP007598_1_3> < ='/f/= =f= =f='> <I><B'cing=0tut langcells'>4565901 ='/f='> <I><B'nocing=0cells'>e"pany="tex"'bISkground:Ytllow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACAC +b>e+='/f='/<"pany="tex" bISkground:B <e>ATAGCCCCGGCAGCGATAGCTAAACCAGTTCC ='/f='> <I><B'cing=0tut langcells'>4565961 ='/f='> <I><B'withcing=0'es/nput href='checkbox'=n" co'checkedSndror[]' valuco NZ_CP007598_1_4> < ='/f/= =f= =f='> <I><B'cing=0tut langcells'>4565962 ='/f='> <I><B'nocing=0cells'>e"pany="tex"'bISkground:Ytllow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACAC +b>e+='/f='/<"pany="tex" bISkground:Sandybrown>GCCTCAAAATCTCTCGGTGAGATGTAAGCGTC ='/f='> <I><B'cing=0tut langcells'>4566022 ='/f='> <I><B'withcing=0'es/nput href='checkbox'=n" co'checkedSndror[]' valuco NZ_CP007598_1_5> < ='/f/= =f= =f='> <I><B'cing=0tut langcells'>4566023 ='/f='> <I><B'nocing=0cells'>e"pany="tex"'bISkground:Ytllow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACAC +b>e+='/f='/<"pany="tex" bISkground:Mediumseagreen>ACCAGTGGTCAGCGGCGGATGAATTTGCCCTG ='/f='> <I><B'cing=0tut langcells'>4566083 ='/f='> <I><B'withcing=0'es/nput href='checkbox'=n" co'checkedSndror[]' valuco NZ_CP007598_1_6> < ='/f/= =f= =f='> <I><B'cing=0tut langcells'>4566084 ='/f='> <I><B'nocing=0cells'>e"pany="tex"'bISkground:Ytllow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACAC +b>e+='/f='/<"pany="tex" bISkground:Steelblu<>GAGAATGCTCATGCGCGTGAGCGCCATATATT ='/f='> <I><B'cing=0tut langcells'>4566144 ='/f='> <I><B'withcing=0'es/nput href='checkbox'=n" co'checkedSndror[]' valuco NZ_CP007598_1_7> < ='/f/= =f= =f='> <I><B'cing=0tut langcells'>4566145 ='/f='> <I><B'nocing=0cells'>e"pany="tex"'bISkground:Ytllow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACAC +b>e+='/f='/<"pany="tex" bISkground:Orchid>CATGGCAATTTTACGGCGGACGTGCTCGCTCT ='/f='> <I><B'cing=0tut langcells'>4566205 ='/f='> <I><B'withcing=0'es/nput href='checkbox'=n" co'checkedSndror[]' valuco NZ_CP007598_1_8> < ='/f/= =f= =f='> <I><B'cing=0tut langcells'>4566206 ='/f='> <I><B'nocing=0cells'>e"pany="tex"'bISkground:Ytllow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACAC +b>e+='/f='/<"pany="tex" bISkground:Llanggrey>AGGCGGACCGAAAAACCGTTTTCAGCCAACGT ='/f='> <I><B'cing=0tut langcells'>4566266 ='/f='> <I><B'withcing=0'es/nput href='checkbox'=n" co'checkedSndror[]' valuco NZ_CP007598_1_9> < ='/f/= =f= =f='> <I><B'cing=0tut langcells'>4566267 ='/f='> <I><B'nocing=0cells'>e"pany="tex"'bISkground:Ytllow'>eb>CGGTTTATCCCCGCTGGCGCGGGGAACAC +b>e+='/f='/< ='/f='> <I><B'cing=0tut langcells'>4566295< ='/ </TABLE= p/c'/f/= = f= =f='/<INPUT <scrip'middls' "-/o'iubmit' valuco'BLAST)indrors' METHOD='post'> s/nput <scrip'middls' href ='reset' valuc ='Reset' > s/nput href="button" valuco"Rent=ne seldentif" onclick="CheckAslINBOX()"= p/c'/f/= =</form=f= = <form aentifa" ead> </s" cead> <bphp" methodt"GET" N" co"s" cDR" oniubmit="popup2();" enchref="appl,Charac/x-www-form-u0tuncoded" return>N"s/nput href="hiddef" n" cond=neq" valucoCGGTTTATCCCCGCTGGCGCGGGGAACAC>ENaf='/<INPUT <scrip"middls" "-/o"iubmit" size=30 valuco"View/h1> </stwith the ste +DR" >ENaf/form=f ='/ </= = "pBR= RIIIII <FORM METHOD="post" ACTIONa" ead> </ead> <bphp" ENC "-/o"multipart/form-is, p> INPUT "-/o"hiddef" n" LANpremiays"VALUETA Hnuage=INPUT "-/o"hiddef" n" LANp> "=VALUETAdefaultuage=INPUT "-/o"hiddef" n" LANead> <_id"=VALUETANZ_CP007598_1">=INPUT "-/o'hiddef' n" LA'checked[]' VALUETNZ_CP007598_1>e= =f='/<TABLEy_table"'ead> <' t="60"'100%'=f= =f='/<"pany="tex"'eolor:#8888FF;'>eb>Lut fripk nequunce : Till pos"sern 4565718 (length =INPUT "-/ssa[/css' CONTENT tut size' VALUEENT100 SIZEENT3 MAXLENGTHENT4 >Ebp) +"pan>e+> CR"pan>< ='/f/= =f= =f='/GGCGAATTGAGCGCCGTAGCCGCGATGTAGTACGGATAATGCTGCCGTTGGTAAAAGAGCTGGCGAAGGCpBR=GGAAAAAACGTCCTGATATGCTGGTGAAAC BR=< ='/f/= =f= =f='/<"pany="tex"'eolor:#8888FF'"eb>Rlang fripk nequunce : From pos"sern 4566295 (length=INPUT "-/ssa[/css' CONTENT langsize' VALUEENT100 SIZEENT3 MAXLENGTHENT4 >Ebp) +> CR"pan>< ='/f/= =f= =f='/ACTAAAACTATATATTTGTTCTAAAAGCCCTTTTTTACTACATAACAAACTACCAACGGTAAGATAACAA BR=TTCCTTATCATTAAAGAACATTCAACTTAT BR=< ='/f/= =f= =f='/<h < ='/f/= =f= =f='/<"pany="tex"'eolor:#8888FF;'>eb>Prinf th")h1> </ nequunce : From pos"sern=INPUT "-/ssa[/css' CONTENT Deb' VALUEENT4565718 SIZEENT8 MAXLENGTHENT12>Ebp To pos"sern=INPUT "-/ssa[/css' CONTENT Fin' VALUEENT4566295 SIZEENT8 MAXLENGTHENT12 >Ebp +> CR"pan>< ='/f/= =f= =f='/< ='/f/= =f= =f='/<INPUT "-/o"iubmit" VALUETAFripk nequunces">="TD/f/= =</FORM></TABLE /< ='/f/= =f= =f='/<class =t=imary BGCOLORe"'#ffffff'=f= =f='/<FORM METHOD='post' ACTIONa ead> </is, repes/Output/000280315/NZ_CP007598/NZ_CP007598_Cad> <_1 ENC "-/o'appl,Charac/x-www-form-u0tuncoded' oniubmit='popup()' ARGETENT _bripk'/<INPUT "-/o"iubmit" VALUETADd> lay/h1> </erizp=0ciestatls" <scrie" beiddls"=</FORM></='/f='/<FORM METHOD='post' ACTIONa' ead> </is, repes/Output/000280315/NZ_CP007598/Sndrors_1" ENC "-/o'appl,Charac/x-www-form-u0tuncoded' oniubmit='popup()' ARGETENT _bripk'/<INPUT "-/o'iubmit' VALUET'Dd> lay/indrors' <scrie" 'middls'=</FORM></='/f/= =f/cells"</='/f/= =f/cells"</nt""eR det +>contdiv A ht +>contdiv A ht