Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NZ_CP008925_1                                                                                                                 top


Strain : Salmonella enterica subsp. enterica serovar Cerro GCF_001941405 RefSeq :NZ_CP008925 (chromosome circular)
CRISPR id : NZ_CP008925_1
DR consensus (29 bp) : CGGTTTATCCCCGCTGGCGCGGGGAACACNumber of repetitions :26
Begin Position : 1900954 End Position : 1902507

1900954GTGTTTATCCCCGCTGACGCGGGGAACATTTTTCAGCCCTTGCCGACTGCGGAACGCCCCT1901014
1901015CGACTTATCCCCGCTGGCGCGGGGAACACATACCGGTTCTGCCATTTCTCGGCTGGATAGC1901075
1901076CGGTTTATCCCCGCTGGCGCGGGGAACACAGAACTATCGGGTAAACAGTTACGATAAAGCG1901136
1901137CGGTTTATCCCCGCTGGCGCGGGGAACACGGTGTTTAATACCGCCATAAGTTGAGCGCGAA1901197
1901198CGGTTTATCCCCGCTGGCGCGGGGAACACACTGAATCCCTCAACCATGAGGGATGCCAGTT1901258
1901259CGGTTTATCCCCGCTGGCGCGGGGAACACAGATATGCATTTGCTGTATTTATTAAACATTT1901319
1901320CGGTTTATCCCCGCTGGCGCGGGGAACACCACACTGTTCGATGATAGCCGCTGAAATGTCG1901380
1901381CGGTTTATCCCCGCTGGCGCGGGGAACACAACAGGAAATGGCTCTACAGCGTCAGGGGATG1901441
1901442CGGTTTATCCCCGCTGGCGCGGGGAACACGAATAAGCCGGTGTAGGTTTCGGGTGCGTGAT1901502
1901503CGGTTTATCCCCGCTGGCGCGGGGAACACGATGTGGTAACAAAGAGATTGGTTTTCCAATC1901563
1901564CGGTTTATCCCCGCTGGCGCGGGGAACACATATTCAAAAACAATATCGAATAAAAAATAAA1901624
1901625CGGTTTATCCCCGCTGGCGCGGGGAACACCGTGTTGATCATCTCCCAATGTTCCAGCATCA1901685
1901686CGGTTTATCCCCGCTGGCGCGGGGAACACAGTGAGTTAATTTATTGTCGCGGCGGCTGTGG1901746
1901747CGGTTTATCCCCGCTGGCGCGGGGAACACGTAATGTCCCCATCTATATTCTGCGCATTCAC1901807
1901808CGGTTTATCCCCGCTGGCGCGGGGAACACCTTAGGGAAATCTCCCGTTATCGTCTTCTGTG1901868
1901869CGGTTTATCCCCGCTGGCGCGGGGAACACTAACCGCGGGTATCGATATGCAGATCGACCGA1901929
1901930CGGTTTATCCCCGCTGGCGCGGGGAACACCTCACCAAACGAAACAACCCCTCCCCAAAGCT1901990
1901991CGGTTTATCCCCGCTGGCGCGGGGAACACGAATGAGAACCCATTTAGAGGTCGAATCACGG1902051
1902052CGGTTTATCCCCGCTGGCGCGGGGAACACTACCTCACCCTGATCCGTGTCGGACGAGGCTG1902112
1902113CGGTTTATCCCCGCTGGCGCGGGGAACACACCTGAGTTAAAGCCGCCAGGCGGCGGCGCGT1902173
1902174CGGTTTATCCCCGCTGGCGCGGGGAACACATTTCGTAAATAACTTTTCCGGCCTGAGTGCG1902234
1902235CGGTTTATCCCCGCTGGCGCGGGGAACACGCGTGTTTTTTTGCTCTGTACCGTTGCGGAGC1902295
1902296CGGTTTATCCCCGCTGGCGCGGGGAACACCCGGGTTGATCAACTGCTGAAAATTTACGCGG1902356
1902357CGGTTTATCCCCGCTGGCGCGGGGAACACGGTTCAGGATGGCAGAAGAGTTCGCAGGGAAG1902417
1902418CGGTTTATCCCCGCTGGCGCGGGGAACACTAATTCTGAAGGGGGGCGAGGCAGTTCCGGTG1902478
1902479CGGTTTATCCCCGCTGGCGCGGGGAACAC1902507
8/span>et"Et#NGTH riib1sitiCgassGTH riib1sitiCgassG"crispr_id" ew CRISPPUT TYPFposition 1902507sME=/TDction="/="/c>td>
Left flanking sequence : Till position 1900954 (length bp)
GGCGAATTGAGCGCCGTAGCCGCGATGTAGTGCGGATAATGCTGCCGTTGGTAAAAGAGCTGGCGAAGGC
GGAAAAAACGTCCTGATATGCTGGTGAAAC
Right flanking sequence : From position 1902507 (length bp)
et"Et#NGTH riib1sitiCgass='nbp)<,pacer[]' vueeiTTiD ENCTYPass=eence : FrT100%'tss='nbp)<,pacer[]' vueeiTTiD ENpost/cYPass=eencean style='color:#8888FFh style='color:#8888FF'>Begin Position :nce : Priget h n 1902507 (length8/span>
e" wid100% >#fffffflor:#8888FF="/crispr/crddle' hp" ENCYPE="muloc','hels/Outrse/tyle='col/BLE class =/BLE class =_C925_1"1-data"> 'lencoded" return> valit" s <=30 va="/="/c>tdrderleft="/crispr/crddle' hp" ENC'YPE="muloc','hels/Outrse/tyle='col/BLE class =/925_1_spr/bdata"> 'lencoded" return>