Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NZ_CP009083_2                                                                                                                 top

Strain : Salmonella enterica subsp. enterica serovar Enteritidis GCF_000750475 RefSeq :NZ_CP009083 (chromosome circular)
CRISPR id : NZ_CP009083_2
DR consensus (29 bp) : CGGTTTATCCCCGCTGGCGCGGGGAACACNumber of repetitions :13
Begin Position : 2971296 End Position : 2972057

2971296ACGGCTATCCTTGTTGGCGCGGGGAACACGGCTACACGCAAAAATTCCAGTCGTTGGCGCA2971356
2971357CGGTTTATCCCCGCTGGCGCGGGGAACACCCGATTAAGATCCG