Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NZ_CP009089_2                                                                                                                 top

RefSeq :NZ_CNu=1) ofder,I089idts9_2
Strain : Salmonella enterica subsp. enterica serovar Enteritidis GCF_000750215 RefSeq :NZ_CP009089 (chromosome circular)
CRISPR id : NZ_CP009089_2
DR consensus (29 bp) : CGGTTTATCCCCGCTGGCGCGGGGAACAC
<122> DR consensus (29 bp) : RefSeq :NZ_CP15 a forp_CRgi-binomepage.b297195olor:#888NZ_CP009no'>spr/HelpTopics/hel!://ml%p89 9'>Z_CACGGCTATCCTTGTTGGCGCGGGGAACAC RefS s/hel!://mlDarkore="e>GGCTACACGCAAAAATTCCAGTCGTTGGCGCAlor:#888NZ_CP009'>297201olor:#888NZ_CP009itle'> NZ_C'} //-->SReper[]' valu_CP009089_2 &nbs_1> ttyle='color:#888NZ_CP009'>2972016lor:#888NZ_CP009no'>spr/HelpTopics/hel!://ml%p89 9'>Z_CCGGTTTATCCCCGCTGGCGCGGGGAACAC RefS s/hel!://mlSpr CCGATTAAGATCCGCAGTCTGCATCAGTAACTlor:#888NZ_CP009'>2972076lor:#888NZ_CP009itle'> NZ_C'} //-->SReper[]' valu_CP009089_2 &nbs_2> ttyle='color:#888NZ_CP009'>2972077lor:#888NZ_CP009no'>spr/HelpTopics/hel!://ml%p89 9'>Z_CCGGTTTATCCCCGCTGGCGAGGGGAACAC RefS s/hel!://mlSkyCGATTCTACGGCAACAGGCCAGGCTGCGACCGlor:#888NZ_CP009'>2972137lor:#888NZ_CP009itle'> NZ_C'} //-->SReper[]' valu_CP009089_2 &nbs_3> ttyle='color:#888NZ_CP009'>2972138lor:#888NZ_CP009no'>spr/HelpTopics/hel!://ml%p89 9'>Z_CCGGTTTATCCCCGCTGGCGCGGGGAACAC RefS s/hel!://mlSienna>ATCAAACATGGAAACCCCTTTAATGAGAGCAAlor:#888NZ_CP009'>2972198lor:#888NZ_CP009itle'> NZ_C'} //-->SReper[]' valu_CP009089_2 &nbs_4> ttyle='color:#888NZ_CP009'>2972199lor:#888NZ_CP009no'>spr/HelpTopics/hel!://ml%p89 9'>Z_CCGGTTTATCCCCGCTGGCGCGGGGAACAC RefS s/hel!://mlNZ_ceTCAGGAACGCGCGGCGGAAGAGCTTGGTGTTTGlor:#888NZ_CP009'>2972260lor:#888NZ_CP009itle'> NZ_C'} //-->SReper[]' valu_CP009089_2 &nbs_5> ttyle='color:#888NZ_CP009'>2972261lor:#888NZ_CP009no'>spr/HelpTopics/hel!://ml%p89 9'>Z_CCGGTTTATCCCCGCTGGCGCGGGGAACAC RefS s/hel!://mlTomato>GCTGCCTTTCCCGGAGTTCCGGCCCCTAAATTlor:#888NZ_CP009'>2972321lor:#888NZ_CP009itle'> NZ_C'} //-->SReper[]' valu_CP009089_2 &nbs_6> ttyle='color:#888NZ_CP009'>2972322lor:#888NZ_CP009no'>spr/HelpTopics/hel!://ml%p89 9'>Z_CGGGTTTATCCCCGCTGGCGCGGGGAACAC RefS s/hel!://mlPapayawhip>TCATGCGCTATAAAAATCAGACTGTCACATGClor:#888NZ_CP009'>2972382lor:#888NZ_CP009itle'> NZ_C'} //-->SReper[]' valu_CP009089_2 &nbs_7> ttyle='color:#888NZ_CP009'>2972383lor:#888NZ_CP009no'>spr/HelpTopics/hel!://ml%p89 9'>Z_CCGGTTTATCCCCGCTGGCGCGGGGAACAC RefS s/hel!://mlPapayawhip>TGATTATTGACGACAACAGCACAGACCGGCAGlor:#888NZ_CP009'>2972443lor:#888NZ_CP009itle'> NZ_C'} //-->SReper[]' valu_CP009089_2 &nbs_8> ttyle='color:#888NZ_CP009'>2972444lor:#888NZ_CP009no'>spr/HelpTopics/hel!://ml%p89 9'>Z_CCAGTTTATCCCCGCTGGCGCGGGGAACAC RefS s/hel!://mlOre="e>AATAATCGGCAATTTGTCCTGGACAGGCACGGlor:#888NZ_CP009'>2972504lor:#888NZ_CP009itle'> NZ_C'} //-->SReper[]' valu_CP009089_2 &nbs_9> ttyle='color:#888NZ_CP009'>297250olor:#888NZ_CP009no'>spr/HelpTopics/hel!://ml%p89 9'>Z_CCAGTTTATCCCCGCTGGCGCGGGGAACAC RefS s/hel!://mlPeru>AATAATCGGCAATTTGTCCTGGACAGGCACGGlor:#888NZ_CP009'>297256olor:#888NZ_CP009itle'> NZ_C'} //-->SReper[]' valu_CP009089_2 &nbs_10> ttyle='color:#888NZ_CP009'>2972566lor:#888NZ_CP009no'>spr/HelpTopics/hel!://ml%p89 9'>Z_CCAGTTTATCCCCGCTGGCGCGGGGAACAC RefS s/hel!://mlOre="ered>GAATCTGGAGGCCAACAGCGCGGCGAAATCCTlor:#888NZ_CP009'>2972626lor:#888NZ_CP009itle'> NZ_C'} //-->SReper[]' valu_CP009089_2 &nbs_11> ttyle='color:#888NZ_CP009'>2972627lor:#888NZ_CP009no'>spr/HelpTopics/hel!://ml%p89 9'>Z_CCAGTTTATCCCCGCTGGCGCGGGGAACAC297265olor:# ginput sité Pmidd ginput []' VALUEE009089_2  &ispr' BGCOLOR='#e0e0e0' width=>DR consensus (29 bp;'>Z_CLris f/a> DR consensus (29 bp) : DR consensus (29 bp;'>Z_CPrirgeth I1equrnce : From pos89idtrINPUTr//DTgmorunct' = 'ibtisDeb' VALUEbti297195o SIZEbti8 MAXLENGTHbti12elbp To pos89idtrINPUTr//DTgmorunct' = 'ibtisFin' VALUEbti297265o SIZEbti8 MAXLENGTHbti12 elbp <0e0#ffffff'lor:#8888FFORM METHOD='post' ACTIONpomepage.loc','hes/Output/style='co/009089_2 &n/009089_2 &n_Cy> '8tINPUTr//DT=" it" VALUEEQD> '8tINPUTr//DT=' it' VALUEE'D>