Institut de Génétique et MiRCRISioTog div clign="lright"> dcripti languges="JavaSripti> dar> C dad> C a href="'/'>Home a/ad> C dad> C a href="'/nderx.php?pges=about'>About RISPR s a/ad> C dad> C a href="'/nderx.php?pges=new'> New' a/ad> C dad> C a href="'/nderx.php?pges=FAQ'> FAQ' a/ad> C dad> C a href=" 'crispr./HelpTopicshealp_RISPR atabase,.tml;' target=new >Help a/ad> C C dad> C a href="'/nderx.php?pges=ontecte'>Cntecte U' a/ad> C C dad> C a href="'/rispr./HelpTopicshexampesh_RISPR atabase,.tml;' target=new>Exampesh C a/ad> C C dad> C a href="'ttp://www.i2mors.u-psud.fr'/' target=new>IGM C a/ad> C a/as> d/abale> div cid"left"mntu>a href="'ttp://www.i-psud.fr'/' dar> Cdad > a href=""/" > dcpanclass=="whiteink ">Home pges /tcpan> a/a> Ca/ad> a/as> dar> C dad> C a href=""/rispr./"> C acpanclass=="whiteink "> RISPR sdatabase,/tcpan> a/a> C dabaleclass=="submntu_abale > C aar> C C dad> C a href=""/rispr./"> C acpanclass=="blueink "> Browse a/a> a/ad> C a/as> C C dar> C C dad> C a href=""/rispr./BLAST/RISPR sBasst.php" > C acpanclass=="blueink "> BLAST a/a> a/ad> C a/as> C dar> C C dad> C a href=""/rispr./RISPR FlankingAign=mnt".php"> C acpanclass=="blueink "> FlankAign= a/a> a/ad> C a/as> C aar> C C dad> C a href=""/rispr./RISPR UtilitiesPges.tml;"> C acpanclass=="blueink "> RISPR sdutilities a/a> a/ad> C a/as> C C C dar> C C dad> C a href=""/RISPR comari/privtae"> C acpanclass=="blueink "> My RISPR sdDB a/a> a/ad> a/as> C Cd/abale> Ca/ad> a/as> dar> C dad> a href=""/Sereri/"> acpanclass=="whiteink "> RISPR sdinder,/tcpan> a/a> Ca/ad> a/as> dar> dad> a href=""/RISPR comari"> acpanclass=="whiteink "> RISPR sdcomariiso= a/a> a/ad> a/as> d/abale>

Other Tools /te2 dar> C dad> C a href=""/RISPR comari/comari/RISPR sComariiso=Pges.php"> C acpanclass=="whiteink "> RISPR comari/tcpan> a/a> a/ad> a/as> dar> dad> a href=""/RISPR comari/Dict/Dict.php"> acpan lass=="whiteink "> RISPR ion,ryo/tcpan>a/a> a/ad> a/as> dar> dad> a href=""/Sereri/"> acpan lass=="whiteink "> RISPR inder,/tcpan>a/a> a/ad> a/as> d/abale>

GPMS Lnk s /te2 < dad> a href=""ttp://wmlvai-psud.fr'/GPMSnew'/"> acpan lass=="whiteink "> GPMS Team /tcpan>a/a> a/ad> a/as> mar> dad> a href=""ttp://wministaellite.u-psud.fr'"> acpan lass=="whiteink "> TadermRepeats,dDBa/a> a/ad> a/as> dar> dad> a href=""ttp://wbcterizal-genotypingi2mors.u-psud.fr'/ a> MLVA Web Sereicea/a> a/ad> a/as> d/abale> dcripti languges="JavaSripti>type="text/cjavasripti> d/cripti>
a hame="Dtop">d/iv >a/iv <
    RISPR sdatails
a href="'#NZ_CP009092_2> NZ_CP009092_2 a href=""/rispr./RISPR FlankingAign=mnt".php?RefSeqs[]=NZ_CP009092">Flankingclign=emnt" toola/a>
  • Pges manurla/Fnte>a/a>    a href=""/rispr./RISPR HomePges.php">img src="/irispr./mages/ibutton/ieomepges.jpeg border="0>Home Pgesa/a> '>a hame=" NZ_CP009092_2>a/a> NZ_CP009092_2                                                                                                                 a href="'#top'>topd/e2 dabaleclass=="rispr.s_abale width=100%a>dad>dad>ab>Strain :d/b> Salmonella etersica subsp. etersica serovar Etersitidis GCF_000750335a/ad>dad>ab> RefSeq :d/b>NZ_CP009092 (chromosome circlarl)a/ad>d/as>das>dad>ab>RISPR did :d/b> NZ_CP009092_2dad>d/as>das>dad>ab>DRcontsensus (29 bp) : d/b> acpanctyles 'bctkground:Yellow'>CGGTTTATCCCCGCTGGCGCGGGGAACACa/ad>dad>ab>Nu,br" ofrepeaitlon,s :d/b>12 d/as>das>dad>ab>Begin Postlon, :d/b> 2971454a/ad>dad>ab> Etd Postlon, :d/b> 2972154a/ad>d/as>d/abale>d/as>das>dad> ation,"'/rgi-binirispr./basst.rgi' method"'GET' Nme="'pacedrF'c>das>dadclass="'order=eft"rightabale'>2971454a/ad>dadclass="'noorder=abale'>acpanctyles 'bctkground:Yellow'>ab>ACGGCTATCCTTGTTGGCGCGGGGAACACa/ad>dad>GGCTACACGCAAAAATTCCAGTCGTTGGCGCAa/ad>dadclass="'order=eft"rightabale'>2971514a/ad>dadclass="'withorder='2971515a/ad>dadclass="'noorder=abale'>acpanctyles 'bctkground:Yellow'>ab>CGGTTTATCCCCGCTGGCGCGGGGAACACa/ad>dad>CCGATTAAGATCCGCAGTCTGCATCAGTAACTa/ad>dadclass="'order=eft"rightabale'>2971575a/ad>dadclass="'withorder='2971576a/ad>dadclass="'noorder=abale'>acpanctyles 'bctkground:Yellow'>ab>CGGTTTATCCCCGCTGGCGAGGGGAACACa/ad>dad>CGATTCTACGGCAACAGGCCAGGCTGCGACCGa/ad>dadclass="'order=eft"rightabale'>2971636a/ad>dadclass="'withorder='2971637a/ad>dadclass="'noorder=abale'>acpanctyles 'bctkground:Yellow'>ab>CGGTTTATCCCCGCTGGCGCGGGGAACACa/ad>dad>ATCAAACATGGAAACCCCTTTAATGAGAGCAAa/ad>dadclass="'order=eft"rightabale'>2971697a/ad>dadclass="'withorder='2971698a/ad>dadclass="'noorder=abale'>acpanctyles 'bctkground:Yellow'>ab>CGGTTTATCCCCGCTGGCGCGGGGAACACa/ad>dad>TCAGGAACGCGCGGCGGAAGAGCTTGGTGTTTGa/ad>dadclass="'order=eft"rightabale'>2971759a/ad>dadclass="'withorder='2971760a/ad>dadclass="'noorder=abale'>acpanctyles 'bctkground:Yellow'>ab>CGGTTTATCCCCGCTGGCGCGGGGAACACa/ad>dad>GCTGCCTTTCCCGGAGTTCCGGCCCCTAAATTa/ad>dadclass="'order=eft"rightabale'>2971820a/ad>dadclass="'withorder='2971821a/ad>dadclass="'noorder=abale'>acpanctyles 'bctkground:Yellow'>ab>GGGTTTATCCCCGCTGGCGCGGGGAACACa/ad>dad>TCATGCGCTATAAAAATCAGACTGTCACATGCa/ad>dadclass="'order=eft"rightabale'>2971881a/ad>dadclass="'withorder='2971882a/ad>dadclass="'noorder=abale'>acpanctyles 'bctkground:Yellow'>ab>CGGTTTATCCCCGCTGGCGCGGGGAACACa/ad>dad>TGATTATTGACGACAACAGCACAGACCGGCAGa/ad>dadclass="'order=eft"rightabale'>2971942a/ad>dadclass="'withorder='2971943a/ad>dadclass="'noorder=abale'>acpanctyles 'bctkground:Yellow'>ab>CAGTTTATCCCCGCTGGCGCGGGGAACACa/ad>dad>AATAATCGGCAATTTGTCCTGGACAGGCACGGa/ad>dadclass="'order=eft"rightabale'>2972003a/ad>dadclass="'withorder='2972004a/ad>dadclass="'noorder=abale'>acpanctyles 'bctkground:Yellow'>ab>CAGTTTATCCCCGCTGGCGCGGGGAACACa/ad>dad>AATAATCGGCAATTTGTCCTGGACAGGCACGGa/ad>dadclass="'order=eft"rightabale'>2972064a/ad>dadclass="'withorder='2972065a/ad>dadclass="'noorder=abale'>acpanctyles 'bctkground:Yellow'>ab>CAGTTTATCCCCGCTGGCGCGGGGAACACa/ad>dad>GAATCTGGAGGCCAACAGCGCGGCGAAATCCTa/ad>dadclass="'order=eft"rightabale'>2972125a/ad>dadclass="'withorder='2972126a/ad>dadclass="'noorder=abale'>acpanctyles 'bctkground:Yellow'>ab>CAGTTTATCCCCGCTGGCGCGGGGAACACa/ad>dad>dadclass="'order=eft"rightabale'>2972154a/ad> d/ad>d/as> das>dad> imnputtype=""button" valu=""Reeriie selction," onclick="CheckAilINBOX()"> d/ad>d/as>das> imnputtype=""hidde," ame="Ddiieq" valu="CGGTTTATCCCCGCTGGCGCGGGGAACAC> dad> d/form>d/ad> dBR>
    dINPUTcYPE ="hidde," AME="dpges"hVALUE"ndefault"> dINPUTcYPE ="hidde," AME="drispr._id"hVALUE"nNZ_CP009092_2">dINPUTcYPE ='hidde,' AME="'checked[]' VALUE"NZ_CP009092_2>aas>dad>das>dad>ab>Lft" flankingciequfnce : Till postlon, 2971454 (length dINPUTcYPE = 'iext/'NAME = 'Aeft"size' VALUE= '100 SIZE= '3 MAXLENGTH= '4 > bp)a/b>d/as>das>dad>ATGGCCTTCTCCTGTAGAAAAGCCTCCCCCGGGAAAACGCGGCCTTTTTACTTTACAGGTTTGTACCAGCdBR>CATTACTGGTACACAGATTATGATTATGCAdBR>d/as>das>dad>ab>Right flankingciequfnce : From postlon, 2972154 (lengthdINPUTcYPE = 'iext/'NAME = 'Arightsize' VALUE= '100 SIZE= '3 MAXLENGTH= '4 > bp)d/as>das>dad>ACTAAACGTATGTCATTGTTTATAAACTACTTTTTATCAGCACCACATTCCACCAACATAATCGCAACAAdBR>TTTAAATTATTAAAGAACAGCTAATTTGCTaBR>d/as>das>dad>
    d/as>das>dad>ab>Print the RISPR diequfnce : From postlon,dINPUTcYPE = 'iext/'NAME = 'ADeb' VALUE= '2971454 SIZE= '8 MAXLENGTH= '12> bp To postlon,dINPUTcYPE = 'iext/'NAME = 'AFin' VALUE= '2972154 SIZE= '8 MAXLENGTH= '12 > bpd/as>das>dad>d/as>das>dad>d/as>d/as>das>dad>dabalec BGCOLOR= '#ffffff'>das>dad>
    dad>
    ENCYPE ='applcation,/x-www-form-u=efncoded' onsubmit='popup()' YARGET= 'A_blank'>d/as>d/abale>d/as>d/abale>a/iv < <