CRISPR details
Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NZ_CP009190_5                                                                                                                 top


Strain : Mycobacterium tuberculosis TRS27 GCF_001998645 RefSeq :NZ_CP009190 (chromosome circular)
CRISPR id : NZ_CP009190_5
DR consensus (36 bp) : GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACNumber of repetitions :2
Begin Position : 3120359 End Position : 3120468

3120359GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACATGCTGAGCTGAGGCGCCGGATGATGGTGGTGCTGANG3120432
3120433GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC3120468
Left flanking sequence : Till position 3120359 (length bp)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNGG
Right flanking sequence : From position 3120468 (length bp)
NNNNNNNNNNNNNNNNNNNNNNNNCGGCTCCCCGAGTTTCCGTCCCCTCTCGGTGTGAACCGCCCCGGTG
AGTCCGGAGACTCTCTGATCTGAGACCTCA

Print the CRISPR sequence : From position bp To position bp