Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NZ_CP009191_3                                                                                                                 top


Strain : Mycobacterium tuberculosis TRS24 GCF_001998705 RefSeq :NZ_CP009191 (chromosome circular)
CRISPR id : NZ_CP009191_3
DR consensus (36 bp) : GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACNumber of repetitions :18
Begin Position : 3119185 End Position : 3120468

3119185GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACTCGGGCACGGCCGAAACACCGCGCGAAGGGCGGTTCAA3119258
3119259GTTTCCGTCCCCTCTCGTGGTTTTGGGTCTGACGACTGGGAGGATGTCACTCGGACATAGCTGTCATCGGCGGTGT3119334
3119335GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGAGGACATGGAGCAGTAGCGTGGCTGTGGTGTGGCGGGCGATATGC3119410
3119411GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACTGCTGCACCTCCCGCACCCGGTGCGATTCTGCGTCCA3119483
3119484GTTTCCGTCCCCTCTCGGGGTTTTGGGTCCGACGACCCCGATAGTCGCGCTCGTCCATGTCCCACCATGAGG3119555
3119556GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACTACCTGATAGAAGCCGGAAAGCTCCGTGCCGTCAG3119626
3119627GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACAGGGCACTGGACCTGTATGAGGCACAGATGGCGTACTA3119700
3119701GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCCGGATCGGTTACCCACGCCGATTTACTGGCCATCGTCGG3119776
3119777GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACACTTGCGCGCACAACGCATCCGCCATCCACGGGGC3119847
3119848GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCTGAAAGGGGGACTGTGGACGAGTTCGCGCTCAAAAT3119920
3119921GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACTTGAACACGCCGATACCTATTTGGTCGGGAGTGATAAA3119994
3119995GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCGGACTTGATCGACGCGAACCTGTCTGACGCGAACCT3120067
3120068GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACGGCTGGAAAAGGGCGCGGGGCAACCGCATCGTCAAGA3120140
3120141GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACGCGTTGTGGTCGTGTCGTGGAGCCTGTATTTCGCTG3120212
3120213GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCATTAGTTGGTGTTGTGATCGCTAAACGCCGGGGCA3120284
3120285GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCTATCCGCGGGAAGAGATCACGAATCCGGCGTCGAAGG3120358
3120359GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACATGCTGAGCTGAGGCGCCGGATGATGGTGGTGCTGAAG3120432
3120433GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC3120468
bp)alghttablecrispr.php" ='resPE="mult'part/forpage','rs/Oute=G/r:#8888FF/='crispr' w/
Left flanking sequence : Till position 3119185 (length bp)
GGCGGGGTCATTTCATGACCAAACGTCCTCACCGTCAACGCCGCCATCATGCTCATCCTGAATGCCGGTC
AACAGACGCGGTGGCGACCCAGTCGTCGTA
Right flanking sequence : From position 3120468 (length bp)
TGACAGGGT://mlvaGTCrAME = 'rightsize''rigllo Righthlor:#8888FF'>Begin Position : 31 posiPrip_pah bp)