Institut de Génétique et Microbiologie

mG'h==); pame=else ii"Tuesday"); else if (xdweeE(); if (xddate==1) xdef (xdyearxdefp R); eame=(_yearxitut de G0 cellocaringG0 (xxdyr>ase,xdyd>ase,x ay.fr/">'/'>Homelanguax a/yd>se,xdyd>se,x ay.fr/">'/cterx.php?p); about'>About elseslang uax a/yd>se,xdyd>se,x ay.fr/">'/cterx.php?p); ); n-uN; nlang uax a/yd>se,xdyd>ase,x ay.fr/">'/cterx.php?p); FAQn-uFAQnlanguax a/yd>se,xdyd> ase,x ay.fr/"> 'ass="co/HelpTopicslp_ elseion, fin.me="' tarst"(); >Helplang uax a/yd>se,xse,xdyd>se,x ay.fr/">'/cterx.php?p); w.i2ary'>C.i2ary Unlanguax a/yd>se,xse,xdyd>se,x ay.fr/">'/ss="co/HelpTopicsExamp/crlang uysis, a/yd>se,xse,xdyd>se,x ay.fr/">'img src="/imtails IGMlanguysis, a/yd>sis, a/yf (xd/yearxg u'img src="/i/title> Navig DNA, eeE2nk rearxdefp R=" xdyr>uysis,dyd >e, analy ay.fr/">"/" >e, analy odapandefp R="whi>Home p); eeapan>, analy aanguysis,a/yd>sea/yf ( xdyr>u,xdyd>ase,xay.fr/">"/ss="co/">ase,x aapandefp R="whi> elseser,Identieeapan>,ax a/a>, analy, analy,e,xdyearxdefp R="sub e,x ayr>uysis,e,xdyd>as analy o,xay.fr/">"/ss="co/">as analy o,x aapandefp R="blu Brow000 elseslaapan>, analy ax a/a>, ana ax a/yd>se,x a/yf (xe,xse,xxdyr>u,xe,xdyd>as analy o,xay.fr/">"/ss="co/BLAST/ elsesBfp t.php" >e, analy o,x aapandefp R="blu BLAST0 elseslaapan>, analy ax a/a>, ax a/yd>se,x a/yf (xese,xxdyr>u,xe,xdyd>as analy o,xay.fr/">"/ss="co/ elseFDatkingAvaSc php">e, analy o,x aapandefp R="blu FDatkAvaSclaapan>, analy ax a/a>, ax a/yd>se,x a/yf ( ase,x ayr>u,xe,xdyd>as analy o,xay.fr/">"/ss="co/ elseUtilitiesP); .me="">e, analy o,xaapandefp R="blu elseseutilitieslaapan>, analy ax a/a>, ax a/yd>se,x a/yf ese,xxxe,xse,xxdyr>uysis,e,xdyd>as analy o,xay.fr/">"/ elsecom/ig/ eav> <">e, analy o,xaapandefp R="blu My elseseDBlaapan>, analy ax a/a>, ana ax a/yd>sna ax a/yf exe,xse,d/yearxg uysis,a/yd>sea/yf ( xdyr>u,xdyd>as analy ay.fr/">"/Sern2A/">as analy oaapandefp R="whi> elseseacterieeapan>, analy aanguysis,a/yd>sea/yf ( xdyr>uysisdyd>as analyay.fr/">"/ elsecom/ig">as analyaapandefp R="whi> elsesecom/igisoclaapan>, analyaanguysisa/yd>snaa/yf (d/yearxg<(xddh2> Other Tools eeE2nk rearxdefp R); ysisdyr>u,xdyd>ase,xay.fr/">"/ elsecom/ig/com/ig/ elsesCom/igisocP); .php">e,e,x aapandefp R="whi> elsecom/igeeapan>,ax a/a>, ana a/yd>sna a/yf as a sisdyr>uysisdyd>as analyay.fr/">"/ elsecom/ig/Dict/Dict.php">eaapans analyefp R="whi> elseDNA,e=(eeapan>aanguysisa/yd>snaa/yf (ly, adyr>uysisdyd>as analyay.fr/">"/Sern2A/">aaapans analyefp R="whi> elseacterieeapan>aanguysisa/yd>snaa/yf (lyyyyy d/yearxg <(xddh2> GPMS L" hs eeE2nkk rearxdefp R); uysisdyd>as analyay.fr/">"img srcmlvai/title> aaapans analyefp R="whi> GPMS Team eeapan>aanguysisa/yd>snaa/yf (lxyr>uysisdyd>as analyay.fr/">"img srcminis> <">aaapans analyefp R="whi> Taterme systemeDBlaapan>aanguysisa/yd>snaa/yf (ly, adyr>uysisdyd>as analyay.fr/">"img srcbaryotial-genotypingimtails MLVA Web Sernicelaapan>aanguysisa/yd>snaa/yf (d/yearxg w.i2bc.paday=new Date(); xddate=todacss"> forms.length; j++) {s nafor (var i = 0; i forms[j].ele forms[j].ele => 'checkbox'){s naye ipt> forms[j].ele forms[j].ele langd/="hgaTuesda elseserf (xdweULd
  • ay.fr/">'#NZ_CP009198_4-uNZ_CP009198_4lang ay.fr/">"/ss="co/ elseFDatkingAvaSc php?RefSeqs[]=NZ_CP009198">FDatkingJavaSce lay. tarst"); I>lp_p); ".fr/">'/ss="co/HelpTopicslp_ elseion, fin.me="#p); _ss="_loc' Onclick="wcteow.open('/ss="co/HelpTopicslp_ elseion, fin.me="#p); _ss="_loc','I>lp_p); ','resizearx=yes,status=no,toolbar=yes,loc DNA,=yes,scrollbars=yes,align=720,t"> lf.i2ecolor="#D83020="0" align="lss="co/eft" alI>lp.jpegitut de G0>P); mnamelaaF.i2>aangu   ay.fr/">"/ss="co/ elseHomeP); .php">0" align="lss="co/eft" albuttonalIomep); .jpegitut de G0>Home P); aanguyaang NZ_CP009198_4                                                                                                                 ay.fr/">'#top'>toplangd/E2ndyearxdefp R="ss="cos_yearxi align=100%t lyf dyd>18 <(xdd/yd>d/yf dyf dyd>Begin Posim,Ch :=else apan> 3119185a/yd>dyd> End Posim,Ch :=else apan> 3120468d/yd>d/yf d/yearxg<(xdd/yd>d/yf dyf dyd>'/sgi-binlss="co/bfp t.sgi' methode'GET' Netai'ocaryrF'J lTABLEdefp R);'ss="cos_yearx' align=100% dyf dydttp://w'ut de et Mpt"> yearx'>3119185a/yd>dydttp://w'nout de yearx'>aapandcss/c;'barkground:Yab>GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAClab>aayd>dyd>TCGGGCACGGCCGAAACACCGCGCGAAGGGCGGTTCAAa/yd>dydttp://w'ut de et Mpt"> yearx'>3119258a/yd>dydttp://w'withut de '"0"nputcss"> 'checkbox'.detai'checkedScaryr[]' valuai NZ_CP009198_4_1> d/yd>d/yf dyf dydttp://w'ut de et Mpt"> yearx'>3119259a/yd>dydttp://w'nout de yearx'>aapandcss/c;'barkground:Yab>GTTTCCGTCCCCTCTCGTGGTTTTGGGTCTGACGAClab>aayd>dyd>TGGGAGGATGTCACTCGGACATAGCTGTCATCGGCGGTGTa/yd>dydttp://w'ut de et Mpt"> yearx'>3119334a/yd>dydttp://w'withut de '"0"nputcss"> 'checkbox'.detai'checkedScaryr[]' valuai NZ_CP009198_4_2> d/yd>d/yf dyf dydttp://w'ut de et Mpt"> yearx'>3119335a/yd>dydttp://w'nout de yearx'>aapandcss/c;'barkground:Yab>GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGAGGAClab>aayd>dyd>ATGGAGCAGTAGCGTGGCTGTGGTGTGGCGGGCGATATGCa/yd>dydttp://w'ut de et Mpt"> yearx'>3119410a/yd>dydttp://w'withut de '"0"nputcss"> 'checkbox'.detai'checkedScaryr[]' valuai NZ_CP009198_4_3> d/yd>d/yf dyf dydttp://w'ut de et Mpt"> yearx'>3119411a/yd>dydttp://w'nout de yearx'>aapandcss/c;'barkground:Yab>GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAClab>aayd>dyd>TGCTGCACCTCCCGCACCCGGTGCGATTCTGCGTCCAa/yd>dydttp://w'ut de et Mpt"> yearx'>3119483a/yd>dydttp://w'withut de '"0"nputcss"> 'checkbox'.detai'checkedScaryr[]' valuai NZ_CP009198_4_4> d/yd>d/yf dyf dydttp://w'ut de et Mpt"> yearx'>3119484a/yd>dydttp://w'nout de yearx'>aapandcss/c;'barkground:Yab>GTTTCCGTCCCCTCTCGGGGTTTTGGGTCCGACGAClab>aayd>dyd>CCCGATAGTCGCGCTCGTCCATGTCCCACCATGAGGa/yd>dydttp://w'ut de et Mpt"> yearx'>3119555a/yd>dydttp://w'withut de '"0"nputcss"> 'checkbox'.detai'checkedScaryr[]' valuai NZ_CP009198_4_5> d/yd>d/yf dyf dydttp://w'ut de et Mpt"> yearx'>3119556a/yd>dydttp://w'nout de yearx'>aapandcss/c;'barkground:Yab>GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAClab>aayd>dyd>TACCTGATAGAAGCCGGAAAGCTCCGTGCCGTCAGa/yd>dydttp://w'ut de et Mpt"> yearx'>3119626a/yd>dydttp://w'withut de '"0"nputcss"> 'checkbox'.detai'checkedScaryr[]' valuai NZ_CP009198_4_6> d/yd>d/yf dyf dydttp://w'ut de et Mpt"> yearx'>3119627a/yd>dydttp://w'nout de yearx'>aapandcss/c;'barkground:Yab>GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAClab>aayd>dyd> skyblu<>AGGGCACTGGACCTGTATGAGGCACAGATGGCGTACTAa/yd>dydttp://w'ut de et Mpt"> yearx'>3119700a/yd>dydttp://w'withut de '"0"nputcss"> 'checkbox'.detai'checkedScaryr[]' valuai NZ_CP009198_4_7> d/yd>d/yf dyf dydttp://w'ut de et Mpt"> yearx'>3119701a/yd>dydttp://w'nout de yearx'>aapandcss/c;'barkground:Yab>GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAClab>aayd>dyd>CCGGATCGGTTACCCACGCCGATTTACTGGCCATCGTCGGa/yd>dydttp://w'ut de et Mpt"> yearx'>3119776a/yd>dydttp://w'withut de '"0"nputcss"> 'checkbox'.detai'checkedScaryr[]' valuai NZ_CP009198_4_8> d/yd>d/yf dyf dydttp://w'ut de et Mpt"> yearx'>3119777a/yd>dydttp://w'nout de yearx'>aapandcss/c;'barkground:Yab>GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAClab>aayd>dyd>ACTTGCGCGCACAACGCATCCGCCATCCACGGGGCa/yd>dydttp://w'ut de et Mpt"> yearx'>3119847a/yd>dydttp://w'withut de '"0"nputcss"> 'checkbox'.detai'checkedScaryr[]' valuai NZ_CP009198_4_9> d/yd>d/yf dyf dydttp://w'ut de et Mpt"> yearx'>3119848a/yd>dydttp://w'nout de yearx'>aapandcss/c;'barkground:Yab>GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAClab>aayd>dyd>CTGAAAGGGGGACTGTGGACGAGTTCGCGCTCAAAATa/yd>dydttp://w'ut de et Mpt"> yearx'>3119920a/yd>dydttp://w'withut de '"0"nputcss"> 'checkbox'.detai'checkedScaryr[]' valuai NZ_CP009198_4_10> d/yd>d/yf dyf dydttp://w'ut de et Mpt"> yearx'>3119921a/yd>dydttp://w'nout de yearx'>aapandcss/c;'barkground:Yab>GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAClab>aayd>dyd>TTGAACACGCCGATACCTATTTGGTCGGGAGTGATAAAa/yd>dydttp://w'ut de et Mpt"> yearx'>3119994a/yd>dydttp://w'withut de '"0"nputcss"> 'checkbox'.detai'checkedScaryr[]' valuai NZ_CP009198_4_11> d/yd>d/yf dyf dydttp://w'ut de et Mpt"> yearx'>3119995a/yd>dydttp://w'nout de yearx'>aapandcss/c;'barkground:Yab>GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAClab>aayd>dyd>CGGACTTGATCGACGCGAACCTGTCTGACGCGAACCTa/yd>dydttp://w'ut de et Mpt"> yearx'>3120067a/yd>dydttp://w'withut de '"0"nputcss"> 'checkbox'.detai'checkedScaryr[]' valuai NZ_CP009198_4_12> d/yd>d/yf dyf dydttp://w'ut de et Mpt"> yearx'>3120068a/yd>dydttp://w'nout de yearx'>aapandcss/c;'barkground:Yab>GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAClab>aayd>dyd>GGCTGGAAAAGGGCGCGGGGCAACCGCATCGTCAAGAa/yd>dydttp://w'ut de et Mpt"> yearx'>3120140a/yd>dydttp://w'withut de '"0"nputcss"> 'checkbox'.detai'checkedScaryr[]' valuai NZ_CP009198_4_13> d/yd>d/yf dyf dydttp://w'ut de et Mpt"> yearx'>3120141a/yd>dydttp://w'nout de yearx'>aapandcss/c;'barkground:Yab>GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAClab>aayd>dyd>GCGTTGTGGTCGTGTCGTGGAGCCTGTATTTCGCTGa/yd>dydttp://w'ut de et Mpt"> yearx'>3120212a/yd>dydttp://w'withut de '"0"nputcss"> 'checkbox'.detai'checkedScaryr[]' valuai NZ_CP009198_4_14> d/yd>d/yf dyf dydttp://w'ut de et Mpt"> yearx'>3120213a/yd>dydttp://w'nout de yearx'>aapandcss/c;'barkground:Yab>GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAClab>aayd>dyd>CATTAGTTGGTGTTGTGATCGCTAAACGCCGGGGCAa/yd>dydttp://w'ut de et Mpt"> yearx'>3120284a/yd>dydttp://w'withut de '"0"nputcss"> 'checkbox'.detai'checkedScaryr[]' valuai NZ_CP009198_4_15> d/yd>d/yf dyf dydttp://w'ut de et Mpt"> yearx'>3120285a/yd>dydttp://w'nout de yearx'>aapandcss/c;'barkground:Yab>GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAClab>aayd>dyd>CTATCCGCGGGAAGAGATCACGAATCCGGCGTCGAAGGa/yd>dydttp://w'ut de et Mpt"> yearx'>3120358a/yd>dydttp://w'withut de '"0"nputcss"> 'checkbox'.detai'checkedScaryr[]' valuai NZ_CP009198_4_16> d/yd>d/yf dyf dydttp://w'ut de et Mpt"> yearx'>3120359a/yd>dydttp://w'nout de yearx'>aapandcss/c;'barkground:Yab>GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAClab>aayd>dyd><>ATGCTGAGCTGAGGCGCCGGATGATGGTGGTGCTGAAGa/yd>dydttp://w'ut de et Mpt"> yearx'>3120432a/yd>dydttp://w'withut de '"0"nputcss"> 'checkbox'.detai'checkedScaryr[]' valuai NZ_CP009198_4_17> d/yd>d/yf dyf dydttp://w'ut de et Mpt"> yearx'>3120433a/yd>dydttp://w'nout de yearx'>aapandcss/c;'barkground:Yab>GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAClab>aayd>dyd>dydttp://w'ut de et Mpt"> yearx'>3120468a/yd> d/yf dyf dyd> 0"nputcavaScr'middrx' ss"> ='reset' valua ='Reset' > 0"nputcss"> "button" valuai"Ren2Ane selram,Ch" onclick="CheckAvlINBOX()" (d/yd>d/yf "lss="co/setass="conphp" methode"GET" Netai"setaDR" onsub it="popup2();" encss"> "applCRISPR /x-www-form-u etncoded" return>,a0"nputcss"> "hiddeh" detaildAneq" valuaiGTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC>e,edyd>e,ed/form d/yd> "lss="co/ss="conphp" ENC4.01="multipart/form-ion,i> xdINPUTJ4.01="hiddeh" CONTENpremiescrVALUEres"n todINPUTJ4.01="hiddeh" CONTENp); ".VALUEredefault todINPUTJ4.01="hiddeh" CONTENss="co_id".VALUEreNZ_CP009198_4">dINPUTJ4.01='hiddeh' CONTE'checked[]' VALUErNZ_CP009198_4>ayf dyd> fDatkingJnequtnce : From posim,Ch 3120468 (lengthdINPUTJ4.01d.fr/hea'm.grissa[pt"> size' VALUEssa100 SIZEssa3 MAXLENGTHssa4 >ebp)lalse apan>d/yd>d/yf dyf dyd>TGACAGGGTGCGGTGGTCGCTGATCGGCTCCCCGAGTTTCCGTCCCCTCTCGGGGTGAACCGCCCCGGTGdBR AGTCCGGAGACTCTCTGATCTGAGACCTCAdBR d/yd>d/yf dyf dyd>d/yf dyf dyd>ab>Pri/b th00 elseJnequtnce : From posim,ChdINPUTJ4.01d.fr/hea'm.grissa[Deb' VALUEssa3119185 SIZEssa8 MAXLENGTHssa12> bp To posim,ChdINPUTJ4.01d.fr/hea'm.grissa[Fin' VALUEssa3120468 SIZEssa8 MAXLENGTHssa12 >ebplalse apan>d/yd>d/yf dyf dyd>d/yd>d/yf dyf dyd>dINPUTJ4.01="sub it" VALUEreFDatkingJnequtnces">laTD>d/yf d/yd>d/yf dyf dyd>d) xdef gyearxd BGCOLOR);'#ffffff' dyf dyd>
    lss="co/ion, fins/Output/001997465/NZ_CP009198/NZ_CP009198_Cs="co_4 ENC4.01='applCRISPR /x-www-form-u etncoded' onsub it='popup()' 4ARGETssa[_bDatk'>dINPUTJ4.01="sub it" VALUEreD="clay elseattepe yieseacrx" avaSc); iddrx"
    dyd>
    'lss="co/ion, fins/Output/001997465/NZ_CP009198/Scaryrs_4- ENC4.01='applCRISPR /x-www-form-u etncoded' onsub it='popup()' 4ARGETssa[_bDatk'>dINPUTJ4.01='sub it' VALUEr'D="clay ocaryrs' avaSc); 'middrx'
    d/yf d/yearxgd/yf d/yearxg