Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NZ_CP009449_4                                                                                                                 top


Strain : Mycobacterium bovis GCF_000758245 RefSeq :NZ_CP009449 (chromosome circular)
CRISPR id : NZ_CP009449_4
DR consensus (36 bp) : GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACNumber of repetitions :13
Begin Position : 3030390 End Position : 3031306

3030390CATGCCGGGGCGGTTCAGGGTTTTGGGTCTGACGACTCGCGGCGAGCACGTCTCACCCAGCAGGCGGTGAGGTTGG3030465
3030466GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACACGGACGAGCTGGACCGCATCAGCGATGCTGAGCTGAGG3030540
3030541GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACTTGTCTCAATCGTGCCGTCTGCGGTGACACGCTCCAA3030613
3030614GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACTCGACGATTGGGACATCGACATCGACGCGATCGTCGACGA3030689
3030690GTTTCCGTCCTCTCTCGGGGTTTTGGGTCTGACGACGTGATCTTCTCTCCTGGCGAGGTCAAGGAAATCGATGTGGA3030766
3030767GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCACCAGGATCAGCGCCAAGCCAGTTAGCGCAATCCA3030838
3030839GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCTCCCGGACCATCTGCAGCTCGCCCGGGTCCATGCG3030910
3030911GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCGGAGTCATCCGCGCGGGCCGGCGCGATTGTTGCCGG3030983
3030984GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGATCCGCGAAATTCACTGCGCGTTATTCAAG3031044
3031045GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCCGAGCCGACCATCCGCATCACACCGAAAGGGTTGGCGCAA3031121
3031122GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACACGTGGGGAGAGGGAATGGCAATGATGGTCGACGAA3031193
3031194GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGACCACGGACAGCATGTCGGCATGCTGCATGCCCTAACGTCGT3031269
3031270GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC3031305
Left flanking sequence : Till position 3030390 (length bp)
TGCGACCATCCGCACCGCCCGCTCACGCAGCTCCGGCGGGTACCTCCTCGATGAACCACCTGACATGACC
CCATCCTTTCCAAGAACTGGAGTCTCCGGA
Right flanking sequence : From position 3031306 (length bp)
GAGCAGACGGCCGCCCCGTCGCCGCCGCCGCTGATCAGCGTGGCTCCCCCCCCCCCTCGGCGCCATCAGA
CACCACCACCAGTGGCGATCGTCAGGCGCG

Print the CRISPR sequence : From position bp To position bp
<> <>