Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links


/a>"> CRISPRR detaiULt
  • le> SPRFlank'0' al.elem tr Tan> r/' tarass cs/hetlepa e="p"> /a Strain :> HocircRegu) 1> CRISid :> Nuecem ofis, rs="gats :> 187870 ib>ACGGCTATCCTTGTTGGCGCGGGGAACACicbpan ACGGCAACGGATGCGACCGCCAGCGCGATCC 187929b b 187930 ib>CCGGTTTATCCCCGCTGCGCGGGGAACACicbpan TTGATGAAAGTTCATCTAATAATGATTGTGCT 187990 b 187991 ib>GGGTTTATCCCCGCTGGCGCAGGGAACACicbpan GAACCGCTTTTATTTTTAGACATAGAGCACCG 188051 b 188052 ib>CGGTTTATCCCCGCTGGCGCGGGGAACACicbpan GCCACCCGGACAACAAAATGAATCCCGATGAT 188112 b 188113 ib>CGGTTTATCCCCGCTGGCGCGGGGAACACicbpan AAACTCTGGGCGCTCGAATGGCTGTCCTATTG 188173 b 188174 ib>CGGTTTATCCCCGCTGGCGCGGGGAACACicbpan TGGCGGTGTAAATTTTTACGTTTTTCATATCT 188234 b 188235 ib>CGGTTTATCCCCGCTGGCGCGGGGAACACicbpan GAGACTTTTCACACTGATAATGTTGTTATTTT 188295 b 188296 ib>CGGTTTATCCCCGCTGGCGCGGGGAACACicbpan GTTGTCGCGGTAGTATTTAGTCGAAAGCATGA 188356 b 188357 ib>CGGTTTATCCCCGCTGGCGCTGGGAACACicbpan ACGGCCTGATTTAGAGTTAAACATGGTCACGC 188417 b 188418 ib>CGGTTTATCCCCGCTGGCGCGGGGAACACicbpan TACGGGTTGTACCATGCCACTGGCGTTTTGTG 188478 b 188479b ib>CGGTTTATCCCCGCTGGCGCGGGGAACACicbpan ATGGCGTGTCTCGATTGCGCGCTGCCGCACTG 188539b b 188540 ib>CGGTTTATCCCCGCTGGCGCGGGGAACACicbpan TTCCCATTTAGCGAGTTCTTTTGCCGCCAGCA 188600 b 188601 ib>CGGTTTATCCCCGCTGGCGCGGGGAACACicbpan 188629b BLAtersprs' METHOD='post'> /'nputp0' aligmiddta' i].typ'reset' valunyp'Reset' > /'nputpt" ty"button" valuna"ReUnive seldetect" onclickason CheckAllINBO"/tr> < CRISPwith the sxdnaDR" hp"> /nt.f/ BR/tr>
    INPUT'DOCT="hiddet" TA NAMplepa VALUEENdefaultght">INPUT'DOCT="hiddet" TA NAMss/cri_ida VALUEENsZ_CP009561_2">>INPUT'DOCT='hiddet' TA NA'i].chec[]' VALUEEsZ_CP009561_2pa ib>L='l fPRFlank'vequ=nce : Till pos="gat 187870 (ts.len >INPUT'DOCTENT e="t'eta NAME n='lsize' VALUEAMEh00 SIZEAME3 MAXLENGTHAME4 hpbp)iceBR/CATTACTGGTACACAGATTATGATTATGCA BR/b R="ri fPRFlank'vequ=nce : From pos="gat 188629 (ts.len>INPUT'DOCTENT e="t'eta NAME s="risize' VALUEAMEh00 SIZEAME3 MAXLENGTHAME4 hpbp)ic INPUT'DOCTENT e="t'eta NAME Deb' VALUEAMEh87870 SIZEAME8 MAXLENGTHAME12> bp To pos="gat>INPUT'DOCTENT e="t'eta NAME Fin' VALUEAMEh88629 SIZEAME8 MAXLENGTHAME12 hpbpic My CRIon, pornieSPRsta" 0' alass =iddta"/
    tersprs' 0' alassgmiddta'/