Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NZ_CP009789_4                                                                                                                 top


Strain : Escherichia coli K-12 GCF_000800765 RefSeq :NZ_CP009789 (chromosome circular)
CRISPR id : NZ_CP009789_4
DR consensus (29 bp) : CGGTTTATCCCCGCTGGCGCGGGGAACTCNumber of repetitions :13
Begin Position : 2861794 End Position : 2862556

2861794CGGTTTATCCCCGCTGATGCGGGGAACACCAGCGTCAGGCGTGAAATCTCACCGTCGTTGC2861854
2861855CGGTTTATCCCTGCTGGCGCGGGGAACTCTCGGTTCAGGCGTTGCAAACCTGGCTACCGGG2861915
2861916CGGTTTATCCCCGCTAACGCGGGGAACTCGTAGTCCATCATTCCACCTATGTCTGAACTCC2861976
2861977CGGTTTATCCCCGCTGGCGCGGGGAACTCCCGGGGGATAATGTTTACGGTCATGCGCCCCC2862037
2862038CGGTTTATCCCCGCTGGCGCGGGGAACTCTGGGCGGCTTGCCTTGCAGCCAGCTCCAGCAG2862098
2862099CGGTTTATCCCCGCTGGCGCGGGGAACTCAAGCTGGCTGGCAATCTCTTTCGGGGTGAGTC2862159
2862160CGGTTTATCCCCGCTGGCGCGGGGAACTCTAGTTTCCGTATCTCCGGATTTATAAAGCTGA2862220
2862221CGGTTTATCCCCGCTGGCGCGGGGAACTCGCAGGCGGCGACGCGCAGGGTATGCGCGATTCG2862282
2862283CGGTTTATCCCCGCTGGCGCGGGGAACTCGCGACCGCTCAGAAATTCCAGACCCGATCCAAA2862344
2862345CGGTTTATCCCCGCTGGCGCGGGGAACTCTCAACATTATCAATTACAACCGACAGGGAGCC2862405
2862406CGGTTTATCCCCGCTGGCGCGGGGAACTCAGCGTGTTCGGCATCACCTTTGGCTTCGGCTG2862466
2862467CGGTTTATCCCCGCTGGCGCGGGGAACTCTGCGTGAGCGTATCGCCGCGCGTCTGCGAAAG2862527
2862528CGGTTTATCCCCGCTGGCGCGGGGAACTC2862556
< GTCTAAAAGTATACATTTGTftmenu">rs_tab width=1100#ffffffyle='color: ACTION="/crign='mrispr.ph" ENCTY_cris_los/Outnam/
Left flanking sequence : Till position 2861794 (length bp)
TTGGCGAAGGCGTCTTGATGGGTTTGAAAATGGGAGCTGGGAGTTCTACCGCAGAGGCGGGGGAACTCCA
AGTGATATCCATCATCGCATCCAGTGCGCC
Right flanking sequence : From position 2862556 (length bp)
TCTAAAAGTATACATTTGTTCTTAAAGCATTTTTTCCCATAAAAACAACCCACCAACCTTAATGTAACAT
TTCCTTATTATTAAAGATCAGCTAATTCTT

Print h> span style='color:#8888FF;ne stint h> NAME = 'rightsize' VALUE = 100 SIZE = 3 MAXLENPUT TYP = 4 > 8p) NAME = 'rightsize' VALUE = 100 SFin = 3 MAXLENPU TYPE = 4 > 8p)
TCTAAAAGTATACATTTGTCTAAAAGTATACATTTGT" NAME="crislue="Vie_4">>
izatple=ie sizeE="su > ass='bor ACTION="/crign='mrispr.ph'" ENCTY_cris_los/Outnam/
ost'> > ass=td>< ass=td><
  • CRISPRtr>ntenv clhttptr>ntenv clhttp