Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NZ_CP010337_3                                                                                                                 top

FF'>FORM METHOD='post' ACTIONPe.jpeg" help_pags/Output/001544955/_3  &nb/_3  &nb_C clas_3u ENCHTML='applion, CR/x-www- -uNudncoded' oe 'bcINPUT HTML=" SPR p NBie < c" Paristd> idd c"FFORM METHOD='post' ACTIONP'e.jpeg" help_pags/Output/001544955/_3  &nb/Ss,prrsLI> ENCHTML='applion, CR/x-www- -uNudncoded' oe 'bcINPUT HTML=' Smidd c'F
Strain : Mycobacterium tubpr>< 9LE class ='crispr' BGCOLOR= F_001544955iv cl'>Strain : Mycobacter g aligbpr>< 9LE clanbsp &n (chromos>FF'>Strain : Mycobacter/div>< 9LE clasa href="/crispr cl'>v cl'/8FF'>FF'>Strain : MycobacterDRMETAsensus (36 bp) : r>< 9LE clasSPRs comn :crikground:Y cow'>GTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC
< cl'>Strain : MycobacterNuday= ofentif< 9LE cla18able cv cl'/8FF'>FF'>Strain : MycobacterBegtubP var jpr>< 9LE clas3125822iv cl'>Strain : Mycobacter EndbP var jpr>< 9LE clas3127104cv cl'/8FF'h2> FF'> 'htt'a>
  • a(var PRdagi-bine.jpeg" bclassagi' methott'GET' N1033'ts,prrF FF'><10337_3>ame= Nud' ="JavBLE c'>3125822iv cl'><10337_3>noame= NBLE c'>Rs comn :crikground:Y cow'>terGTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC< cl'>Strain : >TCGGGCACGGCCGAAACACCGCGCGAAGGGCGGTTCAAiv cl'><10337_3>ame= Nud' ="JavBLE c'>3125895iv cl'><10337_3> cv cl'/8FF'>FF'><10337_3>ame= Nud' ="JavBLE c'>3125896iv cl'><10337_3>noame= NBLE c'>Rs comn :crikground:Y cow'>terGTTTCCGTCCCCTCTCGTGGTTTTGGGTCTGACGAC< cl'>Strain :TGGGAGGATGTCACTCGGACATAGCTGTCATCGGCGGTGTiv cl'><10337_3>ame= Nud' ="JavBLE c'>3125971iv cl'><10337_3> cv cl'/8FF'>FF'><10337_3>ame= Nud' ="JavBLE c'>3125972iv cl'><10337_3>noame= NBLE c'>Rs comn :crikground:Y cow'>terGTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGAGGAC< cl'>Strain :ATGGAGCAGTAGCGTGGCTGTGGTGTGGCGGGCGATATGCiv cl'><10337_3>ame= Nud' ="JavBLE c'>3126047iv cl'><10337_3> cv cl'/8FF'>FF'><10337_3>ame= Nud' ="JavBLE c'>3126048iv cl'><10337_3>noame= NBLE c'>Rs comn :crikground:Y cow'>terGTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC< cl'>Strain :TGCTGCACCTCCCGCACCCGGTGCGATTCTGCGTCCAiv cl'><10337_3>ame= Nud' ="JavBLE c'>3126120iv cl'><10337_3> cv cl'/8FF'>FF'><10337_3>ame= Nud' ="JavBLE c'>3126121iv cl'><10337_3>noame= NBLE c'>Rs comn :crikground:Y cow'>terGTTTCCGTCCCCTCTCGGGGTTTTGGGTCCGACGAC< cl'>Strain :CCCGATAGTCGCGCTCGTCCATGTCCCACCATGAGiv cl'><10337_3>ame= Nud' ="JavBLE c'>3126191iv cl'><10337_3> cv cl'/8FF'>FF'><10337_3>ame= Nud' ="JavBLE c'>3126192iv cl'><10337_3>noame= NBLE c'>Rs comn :crikground:Y cow'>terGGTTTCCGTCCCCTCTCGGGTTTTGGGTCTGACGAC< cl'>Strain :TACCTGATAGAAGCCGGAAAGCTCCGTGCCGTCAGiv cl'><10337_3>ame= Nud' ="JavBLE c'>3126262iv cl'><10337_3> cv cl'/8FF'>FF'><10337_3>ame= Nud' ="JavBLE c'>3126263iv cl'><10337_3>noame= NBLE c'>Rs comn :crikground:Y cow'>terGTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC< cl'>Strain : >AGGGCACTGGACCTGTATGAGGCACAGATGGCGTACTAiv cl'><10337_3>ame= Nud' ="JavBLE c'>3126336iv cl'><10337_3> cv cl'/8FF'>FF'><10337_3>ame= Nud' ="JavBLE c'>3126&nbiv cl'><10337_3>noame= NBLE c'>Rs comn :crikground:Y cow'>terGTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC< cl'>Strain : >CCGGATCGGTTACCCACGCCGATTTACTGGCCATCGTCGGiv cl'><10337_3>ame= Nud' ="JavBLE c'>3126412iv cl'><10337_3> cv cl'/8FF'>FF'><10337_3>ame= Nud' ="JavBLE c'>3126413iv cl'><10337_3>noame= NBLE c'>Rs comn :crikground:Y cow'>terGTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC< cl'>Strain :ACTTGCGCGCACAACGCATCCGCCATCCACGGGGCiv cl'><10337_3>ame= Nud' ="JavBLE c'>3126483iv cl'><10337_3> cv cl'/8FF'>FF'><10337_3>ame= Nud' ="JavBLE c'>3126484iv cl'><10337_3>noame= NBLE c'>Rs comn :crikground:Y cow'>terGTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC< cl'>Strain :CTGAAAGGGGGACTGTGGACGAGTTCGCGCTCAAAATiv cl'><10337_3>ame= Nud' ="JavBLE c'>3126556iv cl'><10337_3> cv cl'/8FF'>FF'><10337_3>ame= Nud' ="JavBLE c'>312655biv cl'><10337_3>noame= NBLE c'>Rs comn :crikground:Y cow'>terGTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC< cl'>Strain :TTGAACACGCCGATACCTATTTGGTCGGGAGTGATAAAiv cl'><10337_3>ame= Nud' ="JavBLE c'>3126630iv cl'><10337_3> cv cl'/8FF'>FF'><10337_3>ame= Nud' ="JavBLE c'>3126631iv cl'><10337_3>noame= NBLE c'>Rs comn :crikground:Y cow'>terGTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC< cl'>Strain :CGGACTTGATCGACGCGAACCTGTCTGACGCGAACCTiv cl'><10337_3>ame= Nud' ="JavBLE c'>3126703iv cl'><10337_3> cv cl'/8FF'>FF'><10337_3>ame= Nud' ="JavBLE c'>3126704iv cl'><10337_3>noame= NBLE c'>Rs comn :crikground:Y cow'>terGTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC< cl'>Strain :GGCTGGAAAAGGGCGCGGGGCAACCGCATCGTCAAGAiv cl'><10337_3>ame= Nud' ="JavBLE c'>3126776iv cl'><10337_3> cv cl'/8FF'>FF'><10337_3>ame= Nud' ="JavBLE c'>312677biv cl'><10337_3>noame= NBLE c'>Rs comn :crikground:Y cow'>terGTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC< cl'>Strain :>GCGTTGTGGTCGTGTCGTGGAGCCTGTATTTCGCTGiv cl'><10337_3>ame= Nud' ="JavBLE c'>3126848iv cl'><10337_3> cv cl'/8FF'>FF'><10337_3>ame= Nud' ="JavBLE c'>3126849iv cl'><10337_3>noame= NBLE c'>Rs comn :crikground:Y cow'>terGTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC< cl'>Strain :CATTAGTTGGTGTTGTGATCGCTAAACGCCGGGGCAiv cl'><10337_3>ame= Nud' ="JavBLE c'>3126920iv cl'><10337_3> cv cl'/8FF'>FF'><10337_3>ame= Nud' ="JavBLE c'>3126921iv cl'><10337_3>noame= NBLE c'>Rs comn :crikground:Y cow'>terGTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC< cl'>Strain :CTATCCGCGGGAAGAGATCACGAATCCGGCGTCGAAGGiv cl'><10337_3>ame= Nud' ="JavBLE c'>3126994iv cl'><10337_3> cv cl'/8FF'>FF'><10337_3>ame= Nud' ="JavBLE c'>3126995iv cl'><10337_3>noame= NBLE c'>Rs comn :crikground:Y cow'>terGTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC< cl'>Strain :ATGCTGAGCTGAGGCGCCGGATGATGGTGGTGCTGAAGiv cl'><10337_3>ame= Nud' ="JavBLE c'>3127068iv cl'><10337_3> cv cl'/8FF'>FF'><10337_3>ame= Nud' ="JavBLE c'>3127069iv cl'><10337_3>noame= NBLE c'>Rs comn :crikground:Y cow'>terGTTTCCGTCCCCTCTCGGGGTTTTGGGTCTGACGAC< cl'>v cl'><10337_3>ame= Nud' ="JavBLE c'>3127104cv cl FF'>INPUT Paris Smidd c' HTML=' ts,prrs' METHOD='post'> ornputfParis Smidd c' cumentar=yet' va ntaR=yet' > ornputfuncti"0>Home" va 3"Re' hee sel progr" oelpTopic= 0; j< documen"ghtcocl'/8FFFF > 'a(var Pge.jpeg" s103v class="blumethott"GET" N1033"s103DR" oe CR'>INPUT Paris "midd c" HTML=" CR'/ F'v cl INPUT HTML="hidder" " Cphelp_VALUE"Edefaultpt"> INPUT HTML="hidder" " Cv clas_idp_VALUE"E_3   "> INPUT HTML='hidder' " '> /table><00%'F'>FF'>Strain : Mycob;'>terLd' fLI> bp)
  • << 9LE clacv cl'/8FF'>FF'>FF'>Strain : MycobacterR"Jav fLI> eequdnce : From p var INPUT HTMLu-psn Ch'tissem.grDeb' VALUEm.g3125822 SIZEm.g8 MAXLENGTHm.g12> bp To p var INPUT HTMLu-psn Ch'tissem.grFin' VALUEm.g3127104 SIZEm.g8 MAXLENGTHm.g12 > bpFF'>FF'> FF'>