Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NZ_CP010371_5                                                                                                                 top

le=FORMst'> _5> NZ_CP01LE class ='crispr' BGCOLOR='#e height= cl'pan style='color:#8888FF'>Begin ;TCCCCLle' fgnement equlncean>Till pb>
Strain : Escherichia coli GCF_000814145 RefSeq :NZ_CP010371 (chromosome circular)
CRISPR id : NZ_CP010371_5
DR consensus (28 bp) : GGTTTATCCCCGCTGGCGCGGGGAACACNumber of repetitions :7
Begin Position : 2957834 End Position : 2958227

2957834GGTTTATCCCCGCTGGCGCGGGGAACTCGACAGAACGGCCTCAGTAGTCTCGTCAGGCTCC2957894
2957895GGTTTATCCCCGCTGGCGCGGGGAACACCTGTTTTCGCAAATCTATGGACTATTGCTATTC2957955
2957956GGTTTATCCCCGCTGGCGCGGGGAACACGGGCGCACGGAATACAAAGCCGTGTATCTGCTC2958016
2958017GGTTTATCCCCGCTGGCGCGGGGAACACTGGCTCTGCAACAGCAGCACCCATGACCACGTC2958077
2958078GGTTTATCCCCGCTGGCGCGGGGAACACGAAATACTGGTGAGCGTTAATGCCGCAAACACA2958138
2958139GGTTTATCCCCGCTGGCGCGGGGAACACATTACGCCTTTTTGCGATTGCCCGGTTTTTGCC2958199
2958200GGTTTATCCCCGCTGGCGCGGGGAACAC2958227
"sdSpDR" odue='BL="popup2();" encpEe 'papplogram,C/x-www-_CP0-uablncoded"s :tur =' typepEe 'ph ='ed" Begin PositR2958 fgnement equlncean>From pb>2958size_CVALUE CO= c SIZE CO3 MAXLENGTH CO4 n /sp><958227Begin ;TCCCCPri equlncean>From pb><958227 NZ_/_5> NZ__C NZ_/alue= s'/cg ENCt' va'applogram,C/x-www-_CP0-uablncoded' odue='BL='popup()mitARspa CON_bgnem'Nt='middt' value='BLASVALUE>'D