Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NZ_CP011113_5                                                                                                                 top


' value otd>
Strain : Escherichia coli GCF_001276585 RefSeq :NZ_CP011113 (chromosome circular)
CRISPR id : NZ_CP011113_5
DR consensus (28 bp) : GGTTTATCCCCGCTGGCGCGGGGAACACNumber of repetitions :7
Begin Position : 2860861 End Position : 2861254

2860861GGTTTATCCCCGCTGGCGCGGGGAACTCGACAGAACGGCCTCAGTAGTCTCGTCAGGCTCC2860921
2860922GGTTTATCCCCGCTGGCGCGGGGAACACCTGTTTTCGCAAATCTATGGACTATTGCTATTC2860982
2860983GGTTTATCCCCGCTGGCGCGGGGAACACGGGCGCACGGAATACAAAGCCGTGTATCTGCTC2861043
2861044GGTTTATCCCCGCTGGCGCGGGGAACACTGGCTCTGCAACAGCAGCACCCATGACCACGTC2861104
2861105GGTTTATCCCCGCTGGCGCGGGGAACACGAAATGCTGGTGAGCGTTAATGCCGCAAACACA2861165
2861166GGTTTATCCCCGCTGGCGCGGGGAACACATTACGCCTTTTTGCGATTGCCCGGTTTTTGCC2861226
2861227GGTTTATCCCCGCTGGCGCGGGGAACAC2861254
Left flanking sequence : Till position 2860861 (length bp)
ATGGAGAACTATTTTGAACATGAGGTGTTACGTGGATATGTTGCTTATTACAAGTACTGCTAATATAAAA
ACTTGAGAAAGAGATAACGGGTTATATGGT
Right flanking sequence : From position 2861254 (length bp)
TCTAAACATAACCTATTATTAATTAATGATTTTTTAAGCCAGTCACAATCTACpan>ACTTGAGAAAGAGATAACGGGTTATATGGT
Right flanking sequence : From position 2861254 (length 2861254

bp)
TCTAAACATAAGATTTTTTAAGCCAGTCACAATCTACpanDeb
ACTTGAGAACTATTGAGATAA8GGGTTATATGGT<12>ACTTGAGAATTATTGAGATAA8GGGTTATATGGT<12R>
5 '<()eveARTTACpan_bpan>'ots ='crispr' p" ENCTn styleD> e, ip '<()eveARTTACpan_bpan>'ots ='crispr'selectionn styl'D> eckAllINBON="/ ' pace='crisprs_tab pace='crisprs_tab ent.php?Re>