Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NZ_CP011259_2                                                                                                                 top

Strain : Salmonella enterica subsp. enterica serovar Agona str. 460004 2-1 GCF_000484195 RefSeq :NZ_CP011259 (chromosome circular)
CRISPR id : NZ_CP011259_2
DR consensus (29 bp) : CGGTTTATCCCCGCTGGCGCGGGGAACACNumber of repetitions :9
Begin Position : 38932 End Position : 39448

38932ACGGCTATCCTTGTTGGCGCGGGGAACACCTGCTCAGCGATAACCGGCAGGTTTAGCCGCT38992
38993CGGTTTATCCCCGCTGACGCGGGGAACACTTGCCGACCAGATCAATGACAACGCTAACCTT39053
39054CGGTTTATCCCCGCTGGCGCGGGGAACACCAGATCACAACGGGTGACGTGATTTTTGGAAA39114
39115CGGTTTATCCCCGCTGGCGCGGGGAACACTCGTTTTTATCTGCATCTCACTCCCCCTTAAC39175
39176CGGTTTATCCCCGCTGGCGCGGGGAACACGCCTAAGCCGGGATTTGCTTTAGGCCAGTTGG39236
39237CGGTTTATCCCCGCTGGCGCGGGGAACACAATAAATGGGATGATCCTGTTGTCCGGGATGC39297
39298CGGTTTATCCCCGCTGGCGCGGGGAACACTCCATCGCTTTTGCCAATCTATCAGACAATTT39358
39359CGGTTTATCCCCGCTGGCGCGGGGAACACGGCGACTAACGGCGTGCTGACCAGCCAGTCGC39419
39420CGGTTTATCCCCGCTGGCGCGGGGAACAC39448
39448
="popup2();" enctr> Flad'miq <" r>ntton" GGGAA'herleE''A,CluGGGAACACtd> nsi'> ble'>38932rleft'> ble'>3893238932" VALUEmeFase.htmlmiquencesng aTDETHODnfpFORM>="Rever dble'>38932

Nubsp. an styletd>#ffffff'>='popup()CGGARei"cont_base.'dbtton" GGGAA"AC" VALUEmeDbaclainder="ype ='reFORM='popup()CGGARei"cont_base.'dbtton" GGGAACAC="ype orderleftrigh"ype orderleftrigh"ement toolan160" ie" cachan160" ie" cach