Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NZ_CP012870_3                                                                                                                 clav>
Strain : Escherichia coli GCF_001308165 RefSeq :NZ_CP012870 (chromosome circular)
CRISPR id : NZ_CP012870_3
DR consensus (29 bp) : GAGTTCCCCGCGCCAGCGGGGATAAACCGNumber of repetitions :13
Begin Position : 1763193 End Position : 1763955

1763193GAGTTCCCCGCGCCAGCGGGGATAAACCGCTTTCGCAGACGCGCGGCGATACGCTCACGCA1763253
1763254GAGTTCCCCGCGCCAGCGGGGATAAACCGCAGCCGAAGCCAAAGGTGATGCCGAACACGCT1763314
1763315GAGTTCCCCGCGCCAGCGGGGATAAACCGGGCTCCCTGTCGGTTGTAATTGATAATGTTGA1763375
1763376GAGTTCCCCGCGCCAGCGGGGATAAACCGTTTGGATCGGGTCTGGAATTTCTGAGCGGTCGC1763437
1763438GAGTTCCCCGCGCCAGCGGGGATAAACCGCGAATCGCGCATACCCTGCGCGTCGCCGCCTGC1763499
1763500GAGTTCCCCGCGCCAGCGGGGATAAACCGTCAGCTTTATAAATCCGGAGATACGGAAACTA1763560
1763561GAGTTCCCCGCGCCAGCGGGGATAAACCGGACTCACCCCGAAAGAGATTGCCAGCCAGCTT1763621
1763622GAGTTCCCCGCGCCAGCGGGGATAAACCGCTGCTGGAGCTGGCTGCAAGGCAAGCCGCCCA1763682
1763683GAGTTCCCCGCGCCAGCGGGGATAAACCGGGGGGCGCATGACCGTAAACATTATCCCCCGG1763743
1763744GAGTTCCCCGCGCCAGCGGGGATAAACCGGGAGTTCAGACATAGGTGGAATGATGGACTAC1763804
1763805GAGTTCCCCGCGTTAGCGGGGATAAACCGCCCGGTAGCCAGGTTTGCAACGCCTGAACCGA1763865
1763866GAGTTCCCCGCGCCAGCAGGGATAAACCGGCAACGACGGTGAGATTTCACGCCTGACGCTG1763926
1763927GTGTTCCCCGCATCAGCGGGGATAAACCG1763955

Left flanking sequence : Till position 1763193 (length bp)
AAGAATTAGCTGATCTTTAATAATAAGGAAATGTTACATTAAGGTTGGTGGGTTGTTTTTATGGGAAAAA
ATGCTTTAAGAACAAATGTATACTTTTAGA
Right flanking sequence : From position 1763955 (length bp)
GGCGCACTGGATGCGATGATGGATATCACTTGGAGTTCCCCCGCCTCTGCGGTAGAACTCCCAGCTCCCA
TTTTCAAACCCATCAAGACGCCTTCGCCAA

Print the CRISPR sequence : From position bp To position bp