Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NZ_CP014051_3                                                                                                                 top

NZ_CP014E class ='crispr' BGCOLOR='#e0height='00%'an style='color:#8888FF'>Begin P;CCGCGLe'> fnement t" quence : Till p>
Strain : Salmonella enterica GCF_001558355 RefSeq :NZ_CP014051 (chromosome circular)
CRISPR id : NZ_CP014051_3
DR consensus (29 bp) : GTGTTCCCCGCGCCAGCGGGGATAAACCGNumber of repetitions :18
Begin Position : 2579172 End Position : 2580240

2579172GTGTTCCCCGCGCCAGCGGGGATAAACCGTGAGCAACGACAGTAAATAATTTTTCGTGCTG2579232
2579233GTGTTCCCCGCGCCAGCGGGGATAAACCGAACCGCTGGCGGGCTGATTGGTCTGCAACCAC2579293
2579294GTGTTCCCCGCGCCAGCGGGGATAAACCGAACCGCTGGCGGGCTGATTGGTCTGCAACCAC2579354
2579355GTGTTCCCCGCGCCAGCGGGGATAAACCGCAACCAGGCTGGATCGTAACTCCTATCCCCTC2579415
2579416GTGTTCCCCGCGCCAGCGGGGATAAACCGCCAGTGGGCGTAGCCAGCTCATCGCTATTTTGC2579477
2579478GTGTTCCCCGCGCCAGCGGGGATAAACCGCGTTGCGGATTATCGTTAAGACTGAAGGAAGT2579538
2579539GTGTTCCCCGCGCCAGCGGGGATAAACCGCGTCACTACCGAGACCGAGACCGAGACCGAGA2579599
2579600GTGTTCCCCGCGCCAGCGGGGATAAACCGCCGCTGACGCACTGGATCAACCTGACGCAACG2579660
2579661GTGTTCCCCGCGCCAGCGGGGATAAACCGTTGCAGGGCGATATTGTTGTTGGTGAATGGGA2579721
2579722GTGTTCCCCGCGCCAGCGGGGATAAACCGCGTCGCGGAAAATTTCGCATTGACGATAAAGA2579782
2579783GTGTTCCCCGCGCCAGCGGGGATAAACCGTTACGTGTTTATTCATCTGTTGCATTAGATTC2579843
2579844GTGTTCCCCGCGCCAGCGGGGATAAACCTGAGGCGTACAGGCTGTTAGATGAGAAATTACC2579904
2579905GTGTTCCCCGCGCCAGCGGGGATAAACCGTGGATTATCTGTATTTTACGGAAGTGGGCGCG2579965
2579966GTGTTCCCCGCGCCAGCGGGGATAAACCGGTCGTTCATCAGGCACTACCGGCACTTTCTGG2580026
2580027GTGTTCCCCGCGCCAGCGGGGATAAACCGATATTCGCCGCTTTCCATTTACCGAACGTAAC2580087
2580088GTGTTCCCCGCGCCAGCGGGGATAAACCGCCACGTTCGGCGATGTTGGCCCCATCGGTCCA2580148
2580149GTGTTCCCCGCGCCAGCGGGGATAAACCGAAACGGTAGTGTTTTAAAACCGTTTCGAGGTGC2580210
2580211GTGTTCCCCGCGCCAGCGGGGATAAACCG2580239
sizeCPVALUECON'00 SIZECON3 MAXLENGTHCON4T cbp)Begin PositiR5802 fnement t" quence : From p>Begin P;CCGCGPri t" quence : From p>T cbp NZ_C/3> NZ_C_Cethod_3" ENC' val'applgram,Ch/x-www-"/cr-CGTencoded'T align='m'2( > ()it'ARameCONT_bneme'Zr'middl' val"lign='" VALUE ractpan iean> es"te' TYle" ='res" d> NZ_C/lue= Ns/cgi ENC' val'applgram,Ch/x-www-"/cr-CGTencoded'T align='m'2( > ()it'ARameCONT_bneme'Zr'middl' value='BLASTVALUE 'Dthola