Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NZ_CP015229_4                                                                                                                 top


Strain : Escherichia coli GCF_001677475 RefSeq :NZ_CP015229 (chromosome circular)
CRISPR id : NZ_CP015229_4
DR consensus (29 bp) : CGGTTTATCCCCGCTGGCGCGGGGAACACNumber of repetitions :11
Begin Position : 3512878 End Position : 3513516

3512878CGGTTTATCCCCGCTGGCGCGGGGAACACCAAATCCAGCCAGCCGCCGACGGTAATCACCC3512938
3512939CGGTTTATCCCCGCTGGCGCGGGGAACACTATGGGGTAGGGCGCTATCAGACATTTACGCA3512999
3513000CGGTTTATCCCCGCTGGCGCGGGGAACACTGCAAGTAACGTTAAGGGAACCGTGGAGACAG3513060
3513061CGGTTTATCCCCGCTGGCGCGGGGAACACTTAGAAAACGCAATGAGCCGCGCGCCCATACC3513121
3513122CGGTTTATCCCCGCTGGCGCGGGGAACACGGCACGCTGGACTGAACAAATCCCTGGGCCAT3513182
3513183CGGTTTATCCCCGCTGGCGCGGGGAACACACTTACAACCACAATAATAAAAAAAGCCTCGT3513243
3513244CGGTTTATCCCCGCTGGCGCGGGGAACACGCCGCTATCTCACCACCAGAACTGTTACCCGT3513304
3513305CGGTTTATCCCCGCTGGCGCGGGGAACACTTGCAGTGGATAGTCATGTAGCCCGCGCGGGC3513365
3513366CGGTTTATCCCCGCTGGCGCGGGGAACACTTTAAATACTGCCGTTCCAGCTTGTTGATCGC3513426
3513427CGGTTTATCCCCGCTGGCGCGGGGAACACCGTAACTGCCTGTACACGCTGTAATGGCTCAC3513487
3513488CGGTTTATCCCCGCTGGCGCGGGGAACAC3513516
Left flanking sequence : Till position 3512878 (length bp)
GTTGGCGAAGGCGTCTTGATGGGTTTGAAAATGGGAGTTGGGAGTTCTACCGCAGGGGCGGGGAACTCCA
AGTGATATCCATCATCGCATCCAGTGCGCC
Right flanking sequence : From position 3513516 (length bp)
ACTAAGCATACATAACTGTTTTTAAACAAATTTATTCCGCATCAACAATCTACCAACTAAATTAAAACAT
TTCCTTATTTTTAAAGAACGGATAACTTAT

Print the CRISPR sequence : From position bp To position bp