Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links





NZ_CP016018_3                                                                                                                 top

Strain : Escherichia coli GCF_001663075 RefSeq :NZ_CP016018 (chromosome circular)
CRISPR id : NZ_CP016018_3
DR consensus (29 bp) : GAGTTCCCCGCGCCAGCGGGGATAAACCGNumber of repetitions :13
Begin Position : 1005300 End Position : 1006062

s_tabls' METHOD='post'> eckedSparis Sumiddbordument.r=yeet eckedSpacer[">Home "/tr> efIONte.jpeg" b class="blue ENCTML ="multipart/'/cg-elp_ href=INPUTPTML ="hiddea" COpremie="DVALUEExpint"> INPUTPTML ="hiddea" COpelp_CVALUEExdefaultt"> INPUTPTML ="hiddea" CO class_id_CVALUEEx
1005300GAGTTCCCCGCGCCAGCGGGGATAAACCGCTTTCGCAGACGCGCGGCGATACGCTCACGCA1005360
1005361GAGTTCCCCGCGCCAGCGGGGATAAACCGCAGCCGAAGCCAAAGGTGATGCCGAACACGCT1005421
1005422GAGTTCCCCGCGCCAGCGGGGATAAACCGGGCTCCCTGTCGGTTGTAATTGATAATGTTGA1005482
1005483GAGTTCCCCGCGCCAGCGGGGATAAACCGTTTGGATCGGGTCTGGAATTTCTGAGCGGTCGC1005544
1005545GAGTTCCCCGCGCCAGCGGGGATAAACCG1005544
1005545GAGTTCCCCGCGCCAGCGGGGATAAACCGyleorderlG bacTttable'>1005482667
1005545GAGTTCCCCGCGCCAGCGGGGATAAACCGeftriCerlefAleordT1005482728
1005545GAGTTCCCCGCGCCAGCGGGGATAAACCGbThtass=htassbThtass=C1005360789
1005545GAGTTCCCCGCGCCAGCGGGGATAAACCGCTTTCGCAGACGCGCGGCGATACGCTSea8ieeTCstylborderGackg= bacAore=Cd>100536085nput type='checkbox' name='checkedSpacer[]' value= NZ_CP016018_3_1>
1005545GAGTTCCCCGCGCCAGCGGGGATAAACCGCAGCCGAAGCCAAAGGTGATGCCGAAKhaki>Gb>efAttable'>100554491nput type='checkbox' name='checkedSpacer[]' value= NZ_CP016018_3_2>
1005545GAGTTCCCCGCGCCAGCGGGGATAAACCG>100536097nput type='checkbox' name='checkedSpacer[]' value= NZ_CP016018_3_3>
1005361GAGTTCCCCGCGCCAGCGGGGATAAACCGCTTTCGCAGACGCGCGGCGATACGCTCAavaScral>/C1005360
1005422GAGTTCCCCGCGCCAGCGGGGATAAACCGATpan style= background:Cyan>CAGable'>1005360
ox' the s + xDR" CRIt/'/cgta
Begin Position : (.forms INPUTPTML -psu Che'issem.gri clasize
Begin Position : 100Rs='w fI>
re=CerTbGb>ATpatd claC/td>Bh='color:#8888FF'>Begin Position : INPUTPTML -psu Che'issem.griDeb SIZE.gr8 MAXLENGTH.gr1derbp To pd> INPUTPTML -psu Che'issem.griFin
dth#ffffff'88FF'>BFORM METHOD='post' >efIONt.jpeg" belp_pages/OutedS/color:#88/3  &nbs/3  &nbs_Cclass_3e ENCTML ='applon, CRI/x-www-'/cg-ud cncoded' ol <'nCINPUTPTML =" PR Ppd:Yie iddbo"tCAGFORM METHOD='post' >efIONt'.jpeg" belp_pages/OutedS/color:#88/3  &nbs/3> umiddbort
lob>