Institut de Génétique et Microbiologie

CRISPR details


Home About CRISPRs News FAQs Help Contact Us Examples IGM
Université Paris Sud

Navigation


Other Tools


GPMS Links


446_5
  • Bsdiv>N9> 446_5 ,'ml#page_c ,'resizaScr=yes,status=no,Topibar=yes,/a> =yes,scrolibars=yes, r>Home>n> mse iicsFt">tent">   LM995446">Flanking aligtd> n> stitut de G_lcris_ Paris buttons md> ge_c.jpeg'>Home>td> n> cs/helpSeqsdiv> bv> bv> -saclay.fr/"> clay.fr'CRISP'
    • < ngAlignment.ptent" ngAlignment.p                                                                                                                 ref="/cris hr'> hr='#NZ_
    • > tcontngAlignment (chromosd> circefen)ipt lp/ge=pse=psud > = "primid :nter> tcont ngAlignment.phpt lpsud > DRn-ussensus (28 bp) : nter> tcont > GGTTTATCCCCGCTGGCGCGGGGAACACghtcontent lpsud > Nudwee ofterizCRI s :nter> tcont7 pt lp/ge=pse=psud > Begin PosRI :nter> tcont 2846539ipt lpsud > End PosRI :nter> tcont 2846932>pt lp/ge=ple"> src'pr/CRISPRFlank a.lengris_gi-binG_lcris_bPRs<'ne syrFble"TABLEtp://mlv'_lcrissud.fr/' P 2846539ipt lpsuclay.fr'noHome/a> > Ub>GGTTTATCCCCGCTGGCGCGGGGAACTCnter> t lpsud > GACAGAACGGCCTCAGTAGTCTCGTCAGGCTCCipt lpsuclay.fr'Home2846599ipt lpsuclay.fr'withHome
    • <'"titlepSe syr[]' valu>< ngAlignment.p_1> rpt lp/ge=pse=psuclay.fr'Home2846600ipt lpsuclay.fr'noHome/a> > Ub>GGTTTATCCCCGCTGGCGCGGGGAACACnter> t lpsud > CTGTTTTCGCAAATCTATGGACTATTGCTATTCipt lpsuclay.fr'Home2846660ipt lpsuclay.fr'withHome
    • <'"titlepSe syr[]' valu>< ngAlignment.p_2> rpt lp/ge=pse=psuclay.fr'Home2846661ipt lpsuclay.fr'noHome/a> > Ub>GGTTTATCCCCGCTGGCGCGGGGAACACnter> t lpsud > <>GGGCGCACGGAATACAAAGCCGTGTATCTGCTCipt lpsuclay.fr'Home2846721ipt lpsuclay.fr'withHome
    • <'"titlepSe syr[]' valu>< ngAlignment.p_3> rpt lp/ge=pse=psuclay.fr'Home2846722ipt lpsuclay.fr'noHome/a> > Ub>GGTTTATCCCCGCTGGCGCGGGGAACACnter> t lpsud > TGGCTCTGCAACAGCAGCACCCATGACCACGTCipt lpsuclay.fr'Home2846782ipt lpsuclay.fr'withHome
    • <'"titlepSe syr[]' valu>< ngAlignment.p_4> rpt lp/ge=pse=psuclay.fr'Home2846783ipt lpsuclay.fr'noHome/a> > Ub>GGTTTATCCCCGCTGGCGCGGGGAACACnter> t lpsud > GAAATGCTGGTGAGCGTTAATGCCGCAAACACAipt lpsuclay.fr'Home2846843ipt lpsuclay.fr'withHome
    • <'"titlepSe syr[]' valu>< ngAlignment.p_5> rpt lp/ge=pse=psuclay.fr'Home2846844ipt lpsuclay.fr'noHome/a> > Ub>GGTTTATCCCCGCTGGCGCGGGGAACACnter> t lpsud > ATTACGCCTTTTTGCGATTGCCCGGTTTTTGCCipt lpsuclay.fr'Home2846904ipt lpsuclay.fr'withHome
    • <'"titlepSe syr[]' valu>< ngAlignment.p_6> rpt lp/ge=pse=psuclay.fr'Home2846905ipt lpsuclay.fr'noHome/a> > Ub>GGTTTATCCCCGCTGGCGCGGGGAACACnter> t lpsud2846932>pt l <' ne syrs' METHOD='post'> Unnput t='50' middr/' checke'reset' valu>ke'Reset' > Unnput for ("button" valu><"Reh2> e selRISPR " oUL> methorc"GET" NLI><"sLI>DR" oUnubmit="popup2();" encfor ("applyotic D/x-www-ipt>-u/> eq" valu> psud<"Viewtable> p/ipt>=ppt l ENCw3.o<"multipart/ipt>-446_class=INPUThw3.o<"hidde " re,datpremiISPRVALUEa nanddateINPUThw3.o<"hidde " re,datpe_criVALUEa defaultddateINPUThw3.o<"hidde " re,dat href=_idriVALUEa ngAlignment.p">eINPUThw3.o<'hidde ' re,da'"titlep[]' VALUEangAlignment.ptege=psud > Ub>L > 00 SIZE'/>3 MAXLENGTH'/>4 > bp)ghtcontener> tcontrpt lp/ge=pse=psudATGGAGAACTATTTTGAACATGAGGTGTTACGTGGATATGTTGCTTATTACAAGTACTGCTAATATAAAApBR ACTTGAGAAAGAGATAACGGGTTATATGGTpBR >pt lp/ge=pse=psud > Rscri f href='/ equ ascrisize' VALUE'/> 00 SIZE'/>3 MAXLENGTH'/>4 > bp)gher> tcontrpt lp/ge=pse=psudTCTAAACATAACCTATTATTAATTAATGATTTTTTAAGCCAGTCACAATCTACCAACTTTATAGTATCACnBR ACAAACAACACATCCATTATGTTAAAGAGCpBR >pt lp/ge=pse=psudpt lp/ge=pse=psud > Ub>Print the = "prim equ Deb' VALUE'/>2846539 SIZE'/>8 MAXLENGTH'/>12> bp To posRI eINPUThw3.oetaiar j'ud.fr'/> Fin' VALUE'/>2846932 SIZE'/>8 MAXLENGTH'/>12 > bpgher> tcontrpt lp/ge=pse=psudrpt lp/ge=pse=psudrINPUThw3.o<"nubmit" VALUEa F href='/ equ< Ns/Output/000952955/ngAlignment/ngAlignment_Chref=_5> ENCw3.o<'applyotic D/x-www-ipt>-u/> _b hre'drINPUThw3.o<"nubmit" VALUEa Dreflar> A,Clp r/" t='50lva.uiddr/"=Ns/Output/000952955/ngAlignment/Se syrsank ENCw3.o<'applyotic D/x-www-ipt>-u/> _b hre'drINPUThw3.o<'nubmit' VALUEa'Dreflar>ne syrs' t='50lva middr/'= /t lp/ge=ple"> /LM995446_5ghepari//wwhtmlghepari//wwhtml